FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640024_at:

>probe:Drosophila_2:1640024_at:238:69; Interrogation_Position=478; Antisense; ATGGCCAAGTCAACTCGGATCACAC
>probe:Drosophila_2:1640024_at:242:711; Interrogation_Position=568; Antisense; TTAAGCGCGAGACCACCTATGACTG
>probe:Drosophila_2:1640024_at:203:71; Interrogation_Position=626; Antisense; AGGCGATGGACGCAGCTACCTGATC
>probe:Drosophila_2:1640024_at:556:673; Interrogation_Position=642; Antisense; TACCTGATCAACCTGCATACCGAAG
>probe:Drosophila_2:1640024_at:54:369; Interrogation_Position=663; Antisense; GAAGGCTACTTCGACCTGATGTGGA
>probe:Drosophila_2:1640024_at:178:383; Interrogation_Position=686; Antisense; GAACGACATCTACCACTATGTTCTG
>probe:Drosophila_2:1640024_at:179:683; Interrogation_Position=702; Antisense; TATGTTCTGTACACGCGCGGAGGTC
>probe:Drosophila_2:1640024_at:272:435; Interrogation_Position=721; Antisense; GAGGTCCCCACTGGCAGATAGCGAA
>probe:Drosophila_2:1640024_at:84:457; Interrogation_Position=737; Antisense; GATAGCGAAGATTCCCTTCTCCAAG
>probe:Drosophila_2:1640024_at:725:249; Interrogation_Position=758; Antisense; CAAGTTCTTCCTGTCTTCCAAGGGA
>probe:Drosophila_2:1640024_at:633:639; Interrogation_Position=832; Antisense; TCGGATTCTCCGTTGCCGCAAAGAA
>probe:Drosophila_2:1640024_at:341:577; Interrogation_Position=867; Antisense; GGCCCGTTTGGCCTGGAAATAGACT
>probe:Drosophila_2:1640024_at:311:529; Interrogation_Position=896; Antisense; GGGTTTGGAGTACGATCCCAGTCAC
>probe:Drosophila_2:1640024_at:513:487; Interrogation_Position=944; Antisense; GTACCAGACTCCCAAATACATCGTG

Paste this into a BLAST search page for me
ATGGCCAAGTCAACTCGGATCACACTTAAGCGCGAGACCACCTATGACTGAGGCGATGGACGCAGCTACCTGATCTACCTGATCAACCTGCATACCGAAGGAAGGCTACTTCGACCTGATGTGGAGAACGACATCTACCACTATGTTCTGTATGTTCTGTACACGCGCGGAGGTCGAGGTCCCCACTGGCAGATAGCGAAGATAGCGAAGATTCCCTTCTCCAAGCAAGTTCTTCCTGTCTTCCAAGGGATCGGATTCTCCGTTGCCGCAAAGAAGGCCCGTTTGGCCTGGAAATAGACTGGGTTTGGAGTACGATCCCAGTCACGTACCAGACTCCCAAATACATCGTG

Full Affymetrix probeset data:

Annotations for 1640024_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720