FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640025_at:

>probe:Drosophila_2:1640025_at:158:101; Interrogation_Position=1088; Antisense; AGAGAAGGGCTCTCAACCAGCGGGA
>probe:Drosophila_2:1640025_at:6:15; Interrogation_Position=1144; Antisense; ATTACGGCCATTGTGGACGAGCGAC
>probe:Drosophila_2:1640025_at:320:577; Interrogation_Position=1176; Antisense; GGCCGCACGCGAAATACTTAACATC
>probe:Drosophila_2:1640025_at:479:521; Interrogation_Position=1201; Antisense; GTGGCACGCCAGATTATCAGCTACA
>probe:Drosophila_2:1640025_at:721:425; Interrogation_Position=661; Antisense; GAGATTACCTACAGTCACTTGGACT
>probe:Drosophila_2:1640025_at:338:609; Interrogation_Position=701; Antisense; TGAGCGACAACAAGCACTTCACCGA
>probe:Drosophila_2:1640025_at:6:131; Interrogation_Position=721; Antisense; ACCGATATTGGGTTCCTGGCCGATA
>probe:Drosophila_2:1640025_at:366:169; Interrogation_Position=750; Antisense; AAAGGCCTGCCTGATCGATTCGATT
>probe:Drosophila_2:1640025_at:326:11; Interrogation_Position=767; Antisense; ATTCGATTGGAACCGACATGCCCAC
>probe:Drosophila_2:1640025_at:162:321; Interrogation_Position=786; Antisense; GCCCACGGACTTCAAGCAGATGTTT
>probe:Drosophila_2:1640025_at:265:557; Interrogation_Position=849; Antisense; GGACGTCATGGATACCTACGAGCAA
>probe:Drosophila_2:1640025_at:176:145; Interrogation_Position=873; Antisense; ACTGCATGTCAAGTACGAGCCGCTG
>probe:Drosophila_2:1640025_at:336:375; Interrogation_Position=897; Antisense; GAAGATCATCAAGCCGCAGTTCGAG
>probe:Drosophila_2:1640025_at:495:553; Interrogation_Position=990; Antisense; GGAGCTGTACGATCTCGACGAGACT

Paste this into a BLAST search page for me
AGAGAAGGGCTCTCAACCAGCGGGAATTACGGCCATTGTGGACGAGCGACGGCCGCACGCGAAATACTTAACATCGTGGCACGCCAGATTATCAGCTACAGAGATTACCTACAGTCACTTGGACTTGAGCGACAACAAGCACTTCACCGAACCGATATTGGGTTCCTGGCCGATAAAAGGCCTGCCTGATCGATTCGATTATTCGATTGGAACCGACATGCCCACGCCCACGGACTTCAAGCAGATGTTTGGACGTCATGGATACCTACGAGCAAACTGCATGTCAAGTACGAGCCGCTGGAAGATCATCAAGCCGCAGTTCGAGGGAGCTGTACGATCTCGACGAGACT

Full Affymetrix probeset data:

Annotations for 1640025_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720