Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640026_at:

>probe:Drosophila_2:1640026_at:318:561; Interrogation_Position=2298; Antisense; GGAAAAGCCGACCTGTAGCCAACAC
>probe:Drosophila_2:1640026_at:497:169; Interrogation_Position=2323; Antisense; AAAGGTCGTACCTATCGCAGGACGA
>probe:Drosophila_2:1640026_at:71:445; Interrogation_Position=2386; Antisense; GATGCGGCCGACTTGAAAACTCCCA
>probe:Drosophila_2:1640026_at:371:389; Interrogation_Position=2400; Antisense; GAAAACTCCCAATTACCATGGCATT
>probe:Drosophila_2:1640026_at:268:453; Interrogation_Position=2470; Antisense; GATCTCCTGGATAATCTCACCGATT
>probe:Drosophila_2:1640026_at:214:539; Interrogation_Position=2495; Antisense; GGTATTTCTCGGGACAAGCTATGAT
>probe:Drosophila_2:1640026_at:421:631; Interrogation_Position=2549; Antisense; TCCGCAAGGCGAATTCCAATCTGAT
>probe:Drosophila_2:1640026_at:324:39; Interrogation_Position=2567; Antisense; ATCTGATCGGTCACTTTGTTGGCTA
>probe:Drosophila_2:1640026_at:628:725; Interrogation_Position=2582; Antisense; TTGTTGGCTATTGTCGCACCTGCGG
>probe:Drosophila_2:1640026_at:14:559; Interrogation_Position=2613; Antisense; GGACACCATTTTCGGTTCGTGGAGC
>probe:Drosophila_2:1640026_at:102:291; Interrogation_Position=2653; Antisense; CGGGATTGCCAGGACATCTGCATGT
>probe:Drosophila_2:1640026_at:140:105; Interrogation_Position=2689; Antisense; AGACGGGATATGCTACGACGATACA
>probe:Drosophila_2:1640026_at:435:367; Interrogation_Position=2733; Antisense; GAATCGATTCAAGGAGCAGCTCTAT
>probe:Drosophila_2:1640026_at:336:559; Interrogation_Position=2808; Antisense; GGAAAAGTGCCACAAGCTTGCTCCT

Paste this into a BLAST search page for me
GGAAAAGCCGACCTGTAGCCAACACAAAGGTCGTACCTATCGCAGGACGAGATGCGGCCGACTTGAAAACTCCCAGAAAACTCCCAATTACCATGGCATTGATCTCCTGGATAATCTCACCGATTGGTATTTCTCGGGACAAGCTATGATTCCGCAAGGCGAATTCCAATCTGATATCTGATCGGTCACTTTGTTGGCTATTGTTGGCTATTGTCGCACCTGCGGGGACACCATTTTCGGTTCGTGGAGCCGGGATTGCCAGGACATCTGCATGTAGACGGGATATGCTACGACGATACAGAATCGATTCAAGGAGCAGCTCTATGGAAAAGTGCCACAAGCTTGCTCCT

Full Affymetrix probeset data:

Annotations for 1640026_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime