FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640028_at:

>probe:Drosophila_2:1640028_at:177:431; Interrogation_Position=102; Antisense; GAGTACCAGCACCACGGATAGCACC
>probe:Drosophila_2:1640028_at:409:55; Interrogation_Position=13; Antisense; ATGAAGTTGTCCCTTGTTCTCTTCG
>probe:Drosophila_2:1640028_at:120:141; Interrogation_Position=130; Antisense; ACGGAATCCACCACAGAGTCTACCA
>probe:Drosophila_2:1640028_at:220:645; Interrogation_Position=166; Antisense; TCTTCATCTAGTTCGGGCTCAAACA
>probe:Drosophila_2:1640028_at:721:165; Interrogation_Position=194; Antisense; AAATCGTGCGTCTCAGCAATCTGAA
>probe:Drosophila_2:1640028_at:669:359; Interrogation_Position=209; Antisense; GCAATCTGAAGTACTCGATCACCAG
>probe:Drosophila_2:1640028_at:326:165; Interrogation_Position=236; Antisense; AAATCAGAGTTGGATCCACCACCAG
>probe:Drosophila_2:1640028_at:674:95; Interrogation_Position=271; Antisense; AGATCCAAAAGTTCCCGCGCCAAGT
>probe:Drosophila_2:1640028_at:167:361; Interrogation_Position=299; Antisense; GCAAGGCCCGTCTAAATGCGGCTAA
>probe:Drosophila_2:1640028_at:16:53; Interrogation_Position=314; Antisense; ATGCGGCTAAACGATCCAAGAAGGC
>probe:Drosophila_2:1640028_at:441:639; Interrogation_Position=35; Antisense; TCGTCCTCTCGATGGTTTTGTATGT
>probe:Drosophila_2:1640028_at:691:107; Interrogation_Position=368; Antisense; AGAACCGCAATGTACGCGTGGTCCG
>probe:Drosophila_2:1640028_at:111:65; Interrogation_Position=56; Antisense; ATGTGGCCCATGTCAGAGCTGCTGA
>probe:Drosophila_2:1640028_at:22:265; Interrogation_Position=81; Antisense; CAGCAGCACAAGCACGGAATCGAGT

Paste this into a BLAST search page for me
GAGTACCAGCACCACGGATAGCACCATGAAGTTGTCCCTTGTTCTCTTCGACGGAATCCACCACAGAGTCTACCATCTTCATCTAGTTCGGGCTCAAACAAAATCGTGCGTCTCAGCAATCTGAAGCAATCTGAAGTACTCGATCACCAGAAATCAGAGTTGGATCCACCACCAGAGATCCAAAAGTTCCCGCGCCAAGTGCAAGGCCCGTCTAAATGCGGCTAAATGCGGCTAAACGATCCAAGAAGGCTCGTCCTCTCGATGGTTTTGTATGTAGAACCGCAATGTACGCGTGGTCCGATGTGGCCCATGTCAGAGCTGCTGACAGCAGCACAAGCACGGAATCGAGT

Full Affymetrix probeset data:

Annotations for 1640028_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720