Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640029_s_at:

>probe:Drosophila_2:1640029_s_at:271:453; Interrogation_Position=125; Antisense; GATCTCAATCGAAATGGAGCTCCAC
>probe:Drosophila_2:1640029_s_at:99:67; Interrogation_Position=138; Antisense; ATGGAGCTCCACATACAGAACAAGT
>probe:Drosophila_2:1640029_s_at:78:187; Interrogation_Position=156; Antisense; AACAAGTGCATCTCGGCATAGCGCA
>probe:Drosophila_2:1640029_s_at:88:347; Interrogation_Position=171; Antisense; GCATAGCGCATCACTCTGGAGGGTG
>probe:Drosophila_2:1640029_s_at:519:679; Interrogation_Position=23; Antisense; TAGTGCGAGGACAGCAGCAGGCAAT
>probe:Drosophila_2:1640029_s_at:664:529; Interrogation_Position=253; Antisense; GGGTCGGCAAAACAAGCATACTACA
>probe:Drosophila_2:1640029_s_at:427:281; Interrogation_Position=281; Antisense; CTCTGTGGCGAGGTTAATATACTTC
>probe:Drosophila_2:1640029_s_at:413:389; Interrogation_Position=313; Antisense; GAAAAAGCTACTTTGTGAGCGTACA
>probe:Drosophila_2:1640029_s_at:178:513; Interrogation_Position=327; Antisense; GTGAGCGTACAAGTTCCATAAGGGT
>probe:Drosophila_2:1640029_s_at:84:115; Interrogation_Position=35; Antisense; AGCAGCAGGCAATATCAAAACAGGA
>probe:Drosophila_2:1640029_s_at:528:457; Interrogation_Position=368; Antisense; GATAGCTCTCAACTGCTAGATAGAG
>probe:Drosophila_2:1640029_s_at:438:101; Interrogation_Position=389; Antisense; AGAGCATTCACACTTGACACTTCTC
>probe:Drosophila_2:1640029_s_at:304:399; Interrogation_Position=404; Antisense; GACACTTCTCAAGGCCTTGAAGCTT
>probe:Drosophila_2:1640029_s_at:57:113; Interrogation_Position=65; Antisense; AGCAGCCGCAGGAGCCAAAGGATCA

Paste this into a BLAST search page for me
GATCTCAATCGAAATGGAGCTCCACATGGAGCTCCACATACAGAACAAGTAACAAGTGCATCTCGGCATAGCGCAGCATAGCGCATCACTCTGGAGGGTGTAGTGCGAGGACAGCAGCAGGCAATGGGTCGGCAAAACAAGCATACTACACTCTGTGGCGAGGTTAATATACTTCGAAAAAGCTACTTTGTGAGCGTACAGTGAGCGTACAAGTTCCATAAGGGTAGCAGCAGGCAATATCAAAACAGGAGATAGCTCTCAACTGCTAGATAGAGAGAGCATTCACACTTGACACTTCTCGACACTTCTCAAGGCCTTGAAGCTTAGCAGCCGCAGGAGCCAAAGGATCA

Full Affymetrix probeset data:

Annotations for 1640029_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime