FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640030_at:

>probe:Drosophila_2:1640030_at:162:431; Interrogation_Position=5274; Antisense; GAGTAGCGGACATTGCACATCTAAC
>probe:Drosophila_2:1640030_at:131:281; Interrogation_Position=5315; Antisense; GGTTTGCAAACTTTACGGGCAGTCA
>probe:Drosophila_2:1640030_at:189:525; Interrogation_Position=5331; Antisense; GGGCAGTCAAATTTTAACAACACAC
>probe:Drosophila_2:1640030_at:680:159; Interrogation_Position=5347; Antisense; ACAACACACACGCAGACATATATAA
>probe:Drosophila_2:1640030_at:282:31; Interrogation_Position=5368; Antisense; ATAAGTACATATCAGTTTGGCAAAA
>probe:Drosophila_2:1640030_at:391:173; Interrogation_Position=5420; Antisense; AAAGCATAATCATGTCATACACAGA
>probe:Drosophila_2:1640030_at:87:665; Interrogation_Position=5437; Antisense; TACACAGACATACACAACTCCAAGC
>probe:Drosophila_2:1640030_at:184:293; Interrogation_Position=5497; Antisense; CGTATCCTTGTTTTTTGCGTTCATT
>probe:Drosophila_2:1640030_at:408:327; Interrogation_Position=5513; Antisense; GCGTTCATTACTCACTATTTCAATG
>probe:Drosophila_2:1640030_at:559:639; Interrogation_Position=5569; Antisense; TCGGTTACAACAATGACAATCGTGA
>probe:Drosophila_2:1640030_at:414:465; Interrogation_Position=5605; Antisense; GTTGTTTACACGACGATGATGCAAA
>probe:Drosophila_2:1640030_at:4:181; Interrogation_Position=5722; Antisense; AAAAGCTGCTGGTATGCCAATTTTT
>probe:Drosophila_2:1640030_at:113:475; Interrogation_Position=5749; Antisense; GTTACCTAACCATTCAGTTTTTCAG
>probe:Drosophila_2:1640030_at:308:477; Interrogation_Position=5773; Antisense; GTTTTCTACCCAACAACTGATGTCC

Paste this into a BLAST search page for me
GAGTAGCGGACATTGCACATCTAACGGTTTGCAAACTTTACGGGCAGTCAGGGCAGTCAAATTTTAACAACACACACAACACACACGCAGACATATATAAATAAGTACATATCAGTTTGGCAAAAAAAGCATAATCATGTCATACACAGATACACAGACATACACAACTCCAAGCCGTATCCTTGTTTTTTGCGTTCATTGCGTTCATTACTCACTATTTCAATGTCGGTTACAACAATGACAATCGTGAGTTGTTTACACGACGATGATGCAAAAAAAGCTGCTGGTATGCCAATTTTTGTTACCTAACCATTCAGTTTTTCAGGTTTTCTACCCAACAACTGATGTCC

Full Affymetrix probeset data:

Annotations for 1640030_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720