Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640031_at:

>probe:Drosophila_2:1640031_at:428:99; Interrogation_Position=1915; Antisense; AGATGTGGAGTACCTGCGCTACTTT
>probe:Drosophila_2:1640031_at:655:91; Interrogation_Position=1956; Antisense; AGTTTCAGTTCCACAAGGCTCTGTG
>probe:Drosophila_2:1640031_at:409:361; Interrogation_Position=1983; Antisense; GCAAGGCCGGACAATATGCGCCCAA
>probe:Drosophila_2:1640031_at:119:683; Interrogation_Position=1997; Antisense; TATGCGCCCAACAATAGTCGTCTGA
>probe:Drosophila_2:1640031_at:694:87; Interrogation_Position=2012; Antisense; AGTCGTCTGACTCTGGACAACTGTG
>probe:Drosophila_2:1640031_at:367:209; Interrogation_Position=2052; Antisense; AAGCAGCTGGACGATCACTGAGCCA
>probe:Drosophila_2:1640031_at:107:609; Interrogation_Position=2070; Antisense; TGAGCCAGTTCCTCTCAAAGGGCAA
>probe:Drosophila_2:1640031_at:396:167; Interrogation_Position=2086; Antisense; AAAGGGCAACTCACGCCATTGGAAG
>probe:Drosophila_2:1640031_at:507:279; Interrogation_Position=2157; Antisense; CTCTGCTGGAGTACTTTGAACCGCT
>probe:Drosophila_2:1640031_at:351:725; Interrogation_Position=2172; Antisense; TTGAACCGCTCTACCAGTGGCTTAA
>probe:Drosophila_2:1640031_at:664:183; Interrogation_Position=2202; Antisense; AAAATAGCCGCTTGGGTGTGCCATT
>probe:Drosophila_2:1640031_at:160:167; Interrogation_Position=2247; Antisense; AAATCCCATCTGATTGCTGTGGAAC
>probe:Drosophila_2:1640031_at:426:139; Interrogation_Position=2270; Antisense; ACGTTTAGCACCTAGACTGAGCCAT
>probe:Drosophila_2:1640031_at:454:415; Interrogation_Position=2288; Antisense; GAGCCATCCCAAACTTGACTTGAGG

Paste this into a BLAST search page for me
AGATGTGGAGTACCTGCGCTACTTTAGTTTCAGTTCCACAAGGCTCTGTGGCAAGGCCGGACAATATGCGCCCAATATGCGCCCAACAATAGTCGTCTGAAGTCGTCTGACTCTGGACAACTGTGAAGCAGCTGGACGATCACTGAGCCATGAGCCAGTTCCTCTCAAAGGGCAAAAAGGGCAACTCACGCCATTGGAAGCTCTGCTGGAGTACTTTGAACCGCTTTGAACCGCTCTACCAGTGGCTTAAAAAATAGCCGCTTGGGTGTGCCATTAAATCCCATCTGATTGCTGTGGAACACGTTTAGCACCTAGACTGAGCCATGAGCCATCCCAAACTTGACTTGAGG

Full Affymetrix probeset data:

Annotations for 1640031_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime