FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640034_at:

>probe:Drosophila_2:1640034_at:668:213; Interrogation_Position=120; Antisense; AAGAGTAGCCGGATACACCGCCTTT
>probe:Drosophila_2:1640034_at:2:711; Interrogation_Position=150; Antisense; TTCAATTGCGATAAGCCTGGACTGA
>probe:Drosophila_2:1640034_at:678:611; Interrogation_Position=172; Antisense; TGAAAGTGTTGGACTACGCCGCAGT
>probe:Drosophila_2:1640034_at:139:457; Interrogation_Position=207; Antisense; GATAGGTTCTACTTGGAGTGCCAGG
>probe:Drosophila_2:1640034_at:327:505; Interrogation_Position=224; Antisense; GTGCCAGGACTACAGGGATTATTTC
>probe:Drosophila_2:1640034_at:8:105; Interrogation_Position=251; Antisense; AGACCCCTATAATCGAGTCCACAAG
>probe:Drosophila_2:1640034_at:604:653; Interrogation_Position=280; Antisense; TAAGGTTTACCTCGTATGCGGGCAA
>probe:Drosophila_2:1640034_at:703:5; Interrogation_Position=322; Antisense; ATACCGACGTTGAGGTCCTTTCTGA
>probe:Drosophila_2:1640034_at:552:607; Interrogation_Position=344; Antisense; TGAGCCGACCTTGTGGCGTATTGAT
>probe:Drosophila_2:1640034_at:629:449; Interrogation_Position=389; Antisense; GATCGACTATCACTCGGATATGGCA
>probe:Drosophila_2:1640034_at:436:537; Interrogation_Position=417; Antisense; GGTAGACGGGACTGCGATCACATTA
>probe:Drosophila_2:1640034_at:644:691; Interrogation_Position=448; Antisense; TTTGTTCGCCAGCTGAGAGCCTAAG
>probe:Drosophila_2:1640034_at:220:679; Interrogation_Position=483; Antisense; TAGGTTGCTGTTGCCATTTTTGTCA
>probe:Drosophila_2:1640034_at:107:99; Interrogation_Position=82; Antisense; AGATGCTCATTCCAGAGGTTGACAT

Paste this into a BLAST search page for me
AAGAGTAGCCGGATACACCGCCTTTTTCAATTGCGATAAGCCTGGACTGATGAAAGTGTTGGACTACGCCGCAGTGATAGGTTCTACTTGGAGTGCCAGGGTGCCAGGACTACAGGGATTATTTCAGACCCCTATAATCGAGTCCACAAGTAAGGTTTACCTCGTATGCGGGCAAATACCGACGTTGAGGTCCTTTCTGATGAGCCGACCTTGTGGCGTATTGATGATCGACTATCACTCGGATATGGCAGGTAGACGGGACTGCGATCACATTATTTGTTCGCCAGCTGAGAGCCTAAGTAGGTTGCTGTTGCCATTTTTGTCAAGATGCTCATTCCAGAGGTTGACAT

Full Affymetrix probeset data:

Annotations for 1640034_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720