FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640035_at:

>probe:Drosophila_2:1640035_at:608:79; Interrogation_Position=350; Antisense; AGGGTGTCCTGCTCGACAAGGATGT
>probe:Drosophila_2:1640035_at:42:139; Interrogation_Position=382; Antisense; ACGATGGGCATGAATCTGACTGGCA
>probe:Drosophila_2:1640035_at:42:583; Interrogation_Position=402; Antisense; TGGCATGATCCAGTCGACGATGATG
>probe:Drosophila_2:1640035_at:106:441; Interrogation_Position=423; Antisense; GATGGCCATGCCCTACATGGACAAG
>probe:Drosophila_2:1640035_at:688:61; Interrogation_Position=469; Antisense; ATGGTGGTTAACATGTCCTCTGTCT
>probe:Drosophila_2:1640035_at:180:63; Interrogation_Position=481; Antisense; ATGTCCTCTGTCTATGGCCTGGAAC
>probe:Drosophila_2:1640035_at:472:337; Interrogation_Position=563; Antisense; GCTCCATGGGCGACAAGATGATCTA
>probe:Drosophila_2:1640035_at:405:443; Interrogation_Position=579; Antisense; GATGATCTACCAAAAGACCGGCGTC
>probe:Drosophila_2:1640035_at:453:211; Interrogation_Position=592; Antisense; AAGACCGGCGTCATGTTCATGGCCA
>probe:Drosophila_2:1640035_at:461:527; Interrogation_Position=624; Antisense; GGGACTCACCAACAGCGAGATGATT
>probe:Drosophila_2:1640035_at:312:461; Interrogation_Position=645; Antisense; GATTATGAACCTGCGCGACAACGTT
>probe:Drosophila_2:1640035_at:285:353; Interrogation_Position=736; Antisense; GCAGCCATGCAAATGATCCACGCGA
>probe:Drosophila_2:1640035_at:587:119; Interrogation_Position=806; Antisense; AGCTGAAGGAGGTTACGCCCACGAT
>probe:Drosophila_2:1640035_at:33:323; Interrogation_Position=822; Antisense; GCCCACGATGCACTGGCAGATGTAA

Paste this into a BLAST search page for me
AGGGTGTCCTGCTCGACAAGGATGTACGATGGGCATGAATCTGACTGGCATGGCATGATCCAGTCGACGATGATGGATGGCCATGCCCTACATGGACAAGATGGTGGTTAACATGTCCTCTGTCTATGTCCTCTGTCTATGGCCTGGAACGCTCCATGGGCGACAAGATGATCTAGATGATCTACCAAAAGACCGGCGTCAAGACCGGCGTCATGTTCATGGCCAGGGACTCACCAACAGCGAGATGATTGATTATGAACCTGCGCGACAACGTTGCAGCCATGCAAATGATCCACGCGAAGCTGAAGGAGGTTACGCCCACGATGCCCACGATGCACTGGCAGATGTAA

Full Affymetrix probeset data:

Annotations for 1640035_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720