FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640039_at:

>probe:Drosophila_2:1640039_at:324:211; Interrogation_Position=108; Antisense; AAGAAGGCTAGCTGCGCGGCAAACT
>probe:Drosophila_2:1640039_at:598:331; Interrogation_Position=123; Antisense; GCGGCAAACTCTTCGATTGGCAATA
>probe:Drosophila_2:1640039_at:396:727; Interrogation_Position=139; Antisense; TTGGCAATACCGAAGGCGCAACCCG
>probe:Drosophila_2:1640039_at:293:615; Interrogation_Position=173; Antisense; TGAATCACCCAACGAGTGTCGGCCT
>probe:Drosophila_2:1640039_at:657:131; Interrogation_Position=225; Antisense; ACCGGCACCGATTTTGAAGCGCGTT
>probe:Drosophila_2:1640039_at:388:605; Interrogation_Position=268; Antisense; TGCAGTGGAATACCGAAGTCCGCCT
>probe:Drosophila_2:1640039_at:588:133; Interrogation_Position=343; Antisense; ACCCGTTTGGGCTATGGCATGCAGG
>probe:Drosophila_2:1640039_at:243:91; Interrogation_Position=382; Antisense; AGTAGCTGTTCCAGTGCCTCATCAG
>probe:Drosophila_2:1640039_at:255:49; Interrogation_Position=408; Antisense; ATCCAATTTTCTGGGCGTGCGCAAG
>probe:Drosophila_2:1640039_at:444:125; Interrogation_Position=436; Antisense; AGCCTGACCTTGAACTCATCGGATA
>probe:Drosophila_2:1640039_at:534:457; Interrogation_Position=457; Antisense; GATATCCGGAACAACAACGATCTGT
>probe:Drosophila_2:1640039_at:693:237; Interrogation_Position=47; Antisense; AATCTCACCACGCTGAGAGCGCTGA
>probe:Drosophila_2:1640039_at:257:401; Interrogation_Position=496; Antisense; GACATGTCGCCTGTGATGAGTGGTA
>probe:Drosophila_2:1640039_at:237:187; Interrogation_Position=75; Antisense; AACAGCGCCGCCTGGAAATAAATAT

Paste this into a BLAST search page for me
AAGAAGGCTAGCTGCGCGGCAAACTGCGGCAAACTCTTCGATTGGCAATATTGGCAATACCGAAGGCGCAACCCGTGAATCACCCAACGAGTGTCGGCCTACCGGCACCGATTTTGAAGCGCGTTTGCAGTGGAATACCGAAGTCCGCCTACCCGTTTGGGCTATGGCATGCAGGAGTAGCTGTTCCAGTGCCTCATCAGATCCAATTTTCTGGGCGTGCGCAAGAGCCTGACCTTGAACTCATCGGATAGATATCCGGAACAACAACGATCTGTAATCTCACCACGCTGAGAGCGCTGAGACATGTCGCCTGTGATGAGTGGTAAACAGCGCCGCCTGGAAATAAATAT

Full Affymetrix probeset data:

Annotations for 1640039_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720