FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640040_at:

>probe:Drosophila_2:1640040_at:365:525; Interrogation_Position=1031; Antisense; GGGAGACGTTGAGCCAAACCGGACT
>probe:Drosophila_2:1640040_at:278:185; Interrogation_Position=1096; Antisense; AAAATGAGCTTTACTCGCCGGCTGA
>probe:Drosophila_2:1640040_at:278:335; Interrogation_Position=1116; Antisense; GCTGATCTTATACATGGCTGCCGTC
>probe:Drosophila_2:1640040_at:131:315; Interrogation_Position=1135; Antisense; GCCGTCAAATGGCAGTCTTTCCGTT
>probe:Drosophila_2:1640040_at:425:89; Interrogation_Position=1148; Antisense; AGTCTTTCCGTTCTTGCATATACCA
>probe:Drosophila_2:1640040_at:99:343; Interrogation_Position=1163; Antisense; GCATATACCACGTGGTGGCCGGAAT
>probe:Drosophila_2:1640040_at:408:565; Interrogation_Position=1183; Antisense; GGAATACTCGATTGTGTGGCGCCAT
>probe:Drosophila_2:1640040_at:603:697; Interrogation_Position=1236; Antisense; TTTACTCCGAATAGGCATGGTCGCC
>probe:Drosophila_2:1640040_at:537:269; Interrogation_Position=1251; Antisense; CATGGTCGCCATCTTTTTGCTAAAT
>probe:Drosophila_2:1640040_at:542:387; Interrogation_Position=1307; Antisense; GAAAAGGACTCTGGCTACGCATCCA
>probe:Drosophila_2:1640040_at:122:347; Interrogation_Position=1325; Antisense; GCATCCAGGGACGTGCAACGACGAA
>probe:Drosophila_2:1640040_at:613:697; Interrogation_Position=1424; Antisense; TTTCATCTTTAATGTGCCCACGGTT
>probe:Drosophila_2:1640040_at:52:33; Interrogation_Position=926; Antisense; ATCAAATGTCGGTGGCGCTTGGCGA
>probe:Drosophila_2:1640040_at:230:287; Interrogation_Position=964; Antisense; CTGGACGCTGCTTATGAGACACTAA

Paste this into a BLAST search page for me
GGGAGACGTTGAGCCAAACCGGACTAAAATGAGCTTTACTCGCCGGCTGAGCTGATCTTATACATGGCTGCCGTCGCCGTCAAATGGCAGTCTTTCCGTTAGTCTTTCCGTTCTTGCATATACCAGCATATACCACGTGGTGGCCGGAATGGAATACTCGATTGTGTGGCGCCATTTTACTCCGAATAGGCATGGTCGCCCATGGTCGCCATCTTTTTGCTAAATGAAAAGGACTCTGGCTACGCATCCAGCATCCAGGGACGTGCAACGACGAATTTCATCTTTAATGTGCCCACGGTTATCAAATGTCGGTGGCGCTTGGCGACTGGACGCTGCTTATGAGACACTAA

Full Affymetrix probeset data:

Annotations for 1640040_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720