Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640042_at:

>probe:Drosophila_2:1640042_at:456:137; Interrogation_Position=2720; Antisense; ACAGTTCTTAACTACGTTTGGATCA
>probe:Drosophila_2:1640042_at:234:109; Interrogation_Position=2853; Antisense; CAGTTTATCGTTGTTAGGTTACCAT
>probe:Drosophila_2:1640042_at:551:485; Interrogation_Position=2878; Antisense; GTAGGATTCCCAGAGCACACAACAA
>probe:Drosophila_2:1640042_at:33:653; Interrogation_Position=2907; Antisense; TCAAAGTTTCAACTCGGTACGCGAA
>probe:Drosophila_2:1640042_at:560:205; Interrogation_Position=3003; Antisense; AAGCGATTTTGTGAGCATTCCCAGT
>probe:Drosophila_2:1640042_at:702:343; Interrogation_Position=3017; Antisense; GCATTCCCAGTACAACTTGTGGCAC
>probe:Drosophila_2:1640042_at:196:273; Interrogation_Position=3032; Antisense; CTTGTGGCACATTTTGGGCAACCGA
>probe:Drosophila_2:1640042_at:313:325; Interrogation_Position=3059; Antisense; GCGAAATTCCAGTTTTGTATCTCAT
>probe:Drosophila_2:1640042_at:187:483; Interrogation_Position=3075; Antisense; GTATCTCATATCACACGAAGCCCAC
>probe:Drosophila_2:1640042_at:112:659; Interrogation_Position=3180; Antisense; TAAGCCCTACTTTATGCTGCTCATT
>probe:Drosophila_2:1640042_at:699:281; Interrogation_Position=3196; Antisense; CTGCTCATTTTACATCCCAAGGGAT
>probe:Drosophila_2:1640042_at:363:679; Interrogation_Position=3220; Antisense; TATACCCTTACCCAAGTTGGAGCCA
>probe:Drosophila_2:1640042_at:144:311; Interrogation_Position=3252; Antisense; TCCAACTATTCCACGTCGCGTATTT
>probe:Drosophila_2:1640042_at:471:327; Interrogation_Position=3269; Antisense; GCGTATTTCCCAGAATCGCCTGAAG

Paste this into a BLAST search page for me
ACAGTTCTTAACTACGTTTGGATCACAGTTTATCGTTGTTAGGTTACCATGTAGGATTCCCAGAGCACACAACAATCAAAGTTTCAACTCGGTACGCGAAAAGCGATTTTGTGAGCATTCCCAGTGCATTCCCAGTACAACTTGTGGCACCTTGTGGCACATTTTGGGCAACCGAGCGAAATTCCAGTTTTGTATCTCATGTATCTCATATCACACGAAGCCCACTAAGCCCTACTTTATGCTGCTCATTCTGCTCATTTTACATCCCAAGGGATTATACCCTTACCCAAGTTGGAGCCATCCAACTATTCCACGTCGCGTATTTGCGTATTTCCCAGAATCGCCTGAAG

Full Affymetrix probeset data:

Annotations for 1640042_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime