FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640044_at:

>probe:Drosophila_2:1640044_at:122:169; Interrogation_Position=1035; Antisense; AAAGGATCAAGGCTCCGGTGGCCCT
>probe:Drosophila_2:1640044_at:674:521; Interrogation_Position=1052; Antisense; GTGGCCCTGTACTACGGCAGTAATG
>probe:Drosophila_2:1640044_at:255:655; Interrogation_Position=1072; Antisense; TAATGATTACCTTTCGGCCGTGGAG
>probe:Drosophila_2:1640044_at:395:549; Interrogation_Position=1093; Antisense; GGAGGATGTACACCGATTGGCCAAA
>probe:Drosophila_2:1640044_at:560:513; Interrogation_Position=1118; Antisense; GTGTTGCCTAATGTGGTCGAGAACC
>probe:Drosophila_2:1640044_at:89:501; Interrogation_Position=1133; Antisense; GTCGAGAACCATCTGTACCGCAAAT
>probe:Drosophila_2:1640044_at:498:219; Interrogation_Position=1186; Antisense; AAGTGCTAGGCGTTCGATTCAACCC
>probe:Drosophila_2:1640044_at:647:459; Interrogation_Position=1201; Antisense; GATTCAACCCAGGATTCTACAAGTG
>probe:Drosophila_2:1640044_at:192:225; Interrogation_Position=1259; Antisense; AAGGATGGCACTACTGGTTCACCCG
>probe:Drosophila_2:1640044_at:472:259; Interrogation_Position=1278; Antisense; CACCCGTGGAAGAGGATGTGCCCCA
>probe:Drosophila_2:1640044_at:215:115; Interrogation_Position=1404; Antisense; AGCAGGTTCAAGTTACCACCAGTCC
>probe:Drosophila_2:1640044_at:629:489; Interrogation_Position=1425; Antisense; GTCCTACCTCGGAACTATAGGTTCT
>probe:Drosophila_2:1640044_at:99:1; Interrogation_Position=1482; Antisense; GTTCCTTAGGTATACGTTGTTCAAT
>probe:Drosophila_2:1640044_at:10:225; Interrogation_Position=994; Antisense; AAGGCTGTACGGACGTTCCACACCG

Paste this into a BLAST search page for me
AAAGGATCAAGGCTCCGGTGGCCCTGTGGCCCTGTACTACGGCAGTAATGTAATGATTACCTTTCGGCCGTGGAGGGAGGATGTACACCGATTGGCCAAAGTGTTGCCTAATGTGGTCGAGAACCGTCGAGAACCATCTGTACCGCAAATAAGTGCTAGGCGTTCGATTCAACCCGATTCAACCCAGGATTCTACAAGTGAAGGATGGCACTACTGGTTCACCCGCACCCGTGGAAGAGGATGTGCCCCAAGCAGGTTCAAGTTACCACCAGTCCGTCCTACCTCGGAACTATAGGTTCTGTTCCTTAGGTATACGTTGTTCAATAAGGCTGTACGGACGTTCCACACCG

Full Affymetrix probeset data:

Annotations for 1640044_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720