FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640045_at:

>probe:Drosophila_2:1640045_at:361:683; Interrogation_Position=112; Antisense; TATCCTCAGCCACTGATGGTGCAAA
>probe:Drosophila_2:1640045_at:716:233; Interrogation_Position=135; Antisense; AATCGACGATTGTGACGCATTGCCC
>probe:Drosophila_2:1640045_at:51:135; Interrogation_Position=149; Antisense; ACGCATTGCCCTGCGATTTGTGGAA
>probe:Drosophila_2:1640045_at:231:43; Interrogation_Position=190; Antisense; ATCGACATCCAATTTGTTGCCACTC
>probe:Drosophila_2:1640045_at:699:625; Interrogation_Position=207; Antisense; TGCCACTCGCAATACCATGAAGAAG
>probe:Drosophila_2:1640045_at:403:373; Interrogation_Position=241; Antisense; GAAGTGCATCTGACCTCGCTGGGAG
>probe:Drosophila_2:1640045_at:218:513; Interrogation_Position=265; Antisense; GTGACCATACCCTATGACCTAGAAG
>probe:Drosophila_2:1640045_at:401:379; Interrogation_Position=286; Antisense; GAAGCCTCCCGTGGCAATGTGTGCA
>probe:Drosophila_2:1640045_at:164:63; Interrogation_Position=302; Antisense; ATGTGTGCAGCAATCTGCTCCATGG
>probe:Drosophila_2:1640045_at:95:323; Interrogation_Position=411; Antisense; GCGCCTAGAAGTTCGTCTGCTGGAC
>probe:Drosophila_2:1640045_at:636:105; Interrogation_Position=446; Antisense; AGAATCGAGTGGTGTCCTGTTTCCT
>probe:Drosophila_2:1640045_at:235:95; Interrogation_Position=515; Antisense; AGATGACTTATAGATTAGGCCGCAA
>probe:Drosophila_2:1640045_at:446:659; Interrogation_Position=596; Antisense; TAAGCAGTTGGCACTTAAGCCCGAC
>probe:Drosophila_2:1640045_at:536:229; Interrogation_Position=95; Antisense; AATGTGCCGACAGCAACTATCCTCA

Paste this into a BLAST search page for me
TATCCTCAGCCACTGATGGTGCAAAAATCGACGATTGTGACGCATTGCCCACGCATTGCCCTGCGATTTGTGGAAATCGACATCCAATTTGTTGCCACTCTGCCACTCGCAATACCATGAAGAAGGAAGTGCATCTGACCTCGCTGGGAGGTGACCATACCCTATGACCTAGAAGGAAGCCTCCCGTGGCAATGTGTGCAATGTGTGCAGCAATCTGCTCCATGGGCGCCTAGAAGTTCGTCTGCTGGACAGAATCGAGTGGTGTCCTGTTTCCTAGATGACTTATAGATTAGGCCGCAATAAGCAGTTGGCACTTAAGCCCGACAATGTGCCGACAGCAACTATCCTCA

Full Affymetrix probeset data:

Annotations for 1640045_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720