Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640047_s_at:

>probe:Drosophila_2:1640047_s_at:165:385; Interrogation_Position=120; Antisense; GAACTATAGGCCAATGTGCGACGTT
>probe:Drosophila_2:1640047_s_at:435:579; Interrogation_Position=128; Antisense; GGCCAATGTGCGACGTTAACGATAA
>probe:Drosophila_2:1640047_s_at:19:295; Interrogation_Position=147; Antisense; CGATAATATAAGCTGCTCGCTGGTT
>probe:Drosophila_2:1640047_s_at:477:335; Interrogation_Position=158; Antisense; GCTGCTCGCTGGTTTTTAAATCGGG
>probe:Drosophila_2:1640047_s_at:603:185; Interrogation_Position=17; Antisense; AACAGGCGTACAGTACAGCTTCCCG
>probe:Drosophila_2:1640047_s_at:624:511; Interrogation_Position=188; Antisense; GTGATGGCTTTGGTCTGGGTAACAT
>probe:Drosophila_2:1640047_s_at:511:659; Interrogation_Position=212; Antisense; TAACCCAAGTAAATGCTCCCAACGG
>probe:Drosophila_2:1640047_s_at:591:491; Interrogation_Position=220; Antisense; GTAAATGCTCCCAACGGAGCCATCG
>probe:Drosophila_2:1640047_s_at:441:415; Interrogation_Position=236; Antisense; GAGCCATCGGCTGTGCATTTTATAT
>probe:Drosophila_2:1640047_s_at:430:701; Interrogation_Position=253; Antisense; TTTTATATCCTGTACTTCTTGAGCT
>probe:Drosophila_2:1640047_s_at:84:489; Interrogation_Position=29; Antisense; GTACAGCTTCCCGACTGCGTGGGAT
>probe:Drosophila_2:1640047_s_at:4:305; Interrogation_Position=39; Antisense; CCGACTGCGTGGGATTTGCGTTTGT
>probe:Drosophila_2:1640047_s_at:432:543; Interrogation_Position=50; Antisense; GGATTTGCGTTTGTGGATTGGCCAT
>probe:Drosophila_2:1640047_s_at:150:467; Interrogation_Position=65; Antisense; GATTGGCCATTTCGGTGTATTCACT

Paste this into a BLAST search page for me
GAACTATAGGCCAATGTGCGACGTTGGCCAATGTGCGACGTTAACGATAACGATAATATAAGCTGCTCGCTGGTTGCTGCTCGCTGGTTTTTAAATCGGGAACAGGCGTACAGTACAGCTTCCCGGTGATGGCTTTGGTCTGGGTAACATTAACCCAAGTAAATGCTCCCAACGGGTAAATGCTCCCAACGGAGCCATCGGAGCCATCGGCTGTGCATTTTATATTTTTATATCCTGTACTTCTTGAGCTGTACAGCTTCCCGACTGCGTGGGATCCGACTGCGTGGGATTTGCGTTTGTGGATTTGCGTTTGTGGATTGGCCATGATTGGCCATTTCGGTGTATTCACT

Full Affymetrix probeset data:

Annotations for 1640047_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime