Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640048_s_at:

>probe:Drosophila_2:1640048_s_at:497:525; Interrogation_Position=103; Antisense; GGGCAGTTTTACAATGCCCAACTGG
>probe:Drosophila_2:1640048_s_at:638:49; Interrogation_Position=116; Antisense; ATGCCCAACTGGAGCCGGCTGCCTA
>probe:Drosophila_2:1640048_s_at:672:195; Interrogation_Position=122; Antisense; AACTGGAGCCGGCTGCCTATGCCTG
>probe:Drosophila_2:1640048_s_at:276:627; Interrogation_Position=135; Antisense; TGCCTATGCCTGTGTTCCTGTCTTG
>probe:Drosophila_2:1640048_s_at:548:683; Interrogation_Position=139; Antisense; TATGCCTGTGTTCCTGTCTTGCCCC
>probe:Drosophila_2:1640048_s_at:610:593; Interrogation_Position=153; Antisense; TGTCTTGCCCCTCAAACCGATAAGC
>probe:Drosophila_2:1640048_s_at:57:321; Interrogation_Position=159; Antisense; GCCCCTCAAACCGATAAGCAATGGA
>probe:Drosophila_2:1640048_s_at:69:201; Interrogation_Position=167; Antisense; AACCGATAAGCAATGGAGTGGGAAC
>probe:Drosophila_2:1640048_s_at:664:431; Interrogation_Position=182; Antisense; GAGTGGGAACCAATAGTCATCAGCA
>probe:Drosophila_2:1640048_s_at:267:563; Interrogation_Position=187; Antisense; GGAACCAATAGTCATCAGCACCATC
>probe:Drosophila_2:1640048_s_at:289:37; Interrogation_Position=239; Antisense; ATCATCACCAACGTCCGCACCAGAA
>probe:Drosophila_2:1640048_s_at:610:353; Interrogation_Position=255; Antisense; GCACCAGAACATCCACAATCACAAC
>probe:Drosophila_2:1640048_s_at:493:203; Interrogation_Position=301; Antisense; AACCAGAACCAGAACAAACGCAAAT
>probe:Drosophila_2:1640048_s_at:59:253; Interrogation_Position=310; Antisense; CAGAACAAACGCAAATTTTCAACCT

Paste this into a BLAST search page for me
GGGCAGTTTTACAATGCCCAACTGGATGCCCAACTGGAGCCGGCTGCCTAAACTGGAGCCGGCTGCCTATGCCTGTGCCTATGCCTGTGTTCCTGTCTTGTATGCCTGTGTTCCTGTCTTGCCCCTGTCTTGCCCCTCAAACCGATAAGCGCCCCTCAAACCGATAAGCAATGGAAACCGATAAGCAATGGAGTGGGAACGAGTGGGAACCAATAGTCATCAGCAGGAACCAATAGTCATCAGCACCATCATCATCACCAACGTCCGCACCAGAAGCACCAGAACATCCACAATCACAACAACCAGAACCAGAACAAACGCAAATCAGAACAAACGCAAATTTTCAACCT

Full Affymetrix probeset data:

Annotations for 1640048_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime