FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640052_at:

>probe:Drosophila_2:1640052_at:69:477; Interrogation_Position=105; Antisense; GTTTTACTCCAAAACTGAAGGAGCT
>probe:Drosophila_2:1640052_at:171:419; Interrogation_Position=125; Antisense; GAGCTGCGAATCATTCTGGATCCCA
>probe:Drosophila_2:1640052_at:710:707; Interrogation_Position=138; Antisense; TTCTGGATCCCAAAGGAGACACTTC
>probe:Drosophila_2:1640052_at:167:423; Interrogation_Position=153; Antisense; GAGACACTTCCAAGGGAGTCAGGGA
>probe:Drosophila_2:1640052_at:602:557; Interrogation_Position=184; Antisense; GGAAAGGTTCTATCCAAACCTGAAG
>probe:Drosophila_2:1640052_at:481:639; Interrogation_Position=234; Antisense; TCGTGCGCGAGTGCTCTGGCGTCCA
>probe:Drosophila_2:1640052_at:631:671; Interrogation_Position=269; Antisense; TACGCCCGCTATGGCAACGGCAAGG
>probe:Drosophila_2:1640052_at:623:359; Interrogation_Position=282; Antisense; GCAACGGCAAGGAAGTGTCCCTCTC
>probe:Drosophila_2:1640052_at:392:677; Interrogation_Position=31; Antisense; TAGACTTACTTCCTGAACATTTCAA
>probe:Drosophila_2:1640052_at:524:135; Interrogation_Position=318; Antisense; ACGCTGCTCCTGACATACACAAAAA
>probe:Drosophila_2:1640052_at:548:249; Interrogation_Position=335; Antisense; CACAAAAACCTGGAAGCGGTTGGCA
>probe:Drosophila_2:1640052_at:627:729; Interrogation_Position=354; Antisense; TTGGCAAATAGAACTTACGCTGGAA
>probe:Drosophila_2:1640052_at:405:223; Interrogation_Position=76; Antisense; AATGGGTATTACTCTGTTCCGATTG
>probe:Drosophila_2:1640052_at:8:471; Interrogation_Position=91; Antisense; GTTCCGATTGGCCAGTTTTACTCCA

Paste this into a BLAST search page for me
GTTTTACTCCAAAACTGAAGGAGCTGAGCTGCGAATCATTCTGGATCCCATTCTGGATCCCAAAGGAGACACTTCGAGACACTTCCAAGGGAGTCAGGGAGGAAAGGTTCTATCCAAACCTGAAGTCGTGCGCGAGTGCTCTGGCGTCCATACGCCCGCTATGGCAACGGCAAGGGCAACGGCAAGGAAGTGTCCCTCTCTAGACTTACTTCCTGAACATTTCAAACGCTGCTCCTGACATACACAAAAACACAAAAACCTGGAAGCGGTTGGCATTGGCAAATAGAACTTACGCTGGAAAATGGGTATTACTCTGTTCCGATTGGTTCCGATTGGCCAGTTTTACTCCA

Full Affymetrix probeset data:

Annotations for 1640052_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720