FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640053_at:

>probe:Drosophila_2:1640053_at:189:383; Interrogation_Position=105; Antisense; GAACTTCATCGGGACACTCAAGGGA
>probe:Drosophila_2:1640053_at:333:223; Interrogation_Position=124; Antisense; AAGGGATTCGACCAGACCATCAATA
>probe:Drosophila_2:1640053_at:385:677; Interrogation_Position=155; Antisense; TAGACGAGTGCCATGAGCGCGTCTT
>probe:Drosophila_2:1640053_at:249:281; Interrogation_Position=189; Antisense; CTCCGGCATCGAGCAAATCGTGCTG
>probe:Drosophila_2:1640053_at:676:235; Interrogation_Position=204; Antisense; AATCGTGCTGGGACTGCACATCATC
>probe:Drosophila_2:1640053_at:582:397; Interrogation_Position=235; Antisense; GACAACATCGCGGTGATCGGACTGA
>probe:Drosophila_2:1640053_at:364:601; Interrogation_Position=257; Antisense; TGATAGACGAGACCATCGACTCCCG
>probe:Drosophila_2:1640053_at:255:633; Interrogation_Position=277; Antisense; TCCCGCCTGGATTTGGCCAACATTA
>probe:Drosophila_2:1640053_at:136:287; Interrogation_Position=313; Antisense; CTGGGTCCCGTGGTGCACTAGGATA
>probe:Drosophila_2:1640053_at:282:405; Interrogation_Position=36; Antisense; GACTGCTAAAATGTCCGGTCTGGAG
>probe:Drosophila_2:1640053_at:15:505; Interrogation_Position=48; Antisense; GTCCGGTCTGGAGTCGTATATCAAT
>probe:Drosophila_2:1640053_at:194:483; Interrogation_Position=63; Antisense; GTATATCAATCACACAGTCTCCATC
>probe:Drosophila_2:1640053_at:505:157; Interrogation_Position=74; Antisense; ACACAGTCTCCATCATTACGGCAGA
>probe:Drosophila_2:1640053_at:499:705; Interrogation_Position=89; Antisense; TTACGGCAGACGGACGGAACTTCAT

Paste this into a BLAST search page for me
GAACTTCATCGGGACACTCAAGGGAAAGGGATTCGACCAGACCATCAATATAGACGAGTGCCATGAGCGCGTCTTCTCCGGCATCGAGCAAATCGTGCTGAATCGTGCTGGGACTGCACATCATCGACAACATCGCGGTGATCGGACTGATGATAGACGAGACCATCGACTCCCGTCCCGCCTGGATTTGGCCAACATTACTGGGTCCCGTGGTGCACTAGGATAGACTGCTAAAATGTCCGGTCTGGAGGTCCGGTCTGGAGTCGTATATCAATGTATATCAATCACACAGTCTCCATCACACAGTCTCCATCATTACGGCAGATTACGGCAGACGGACGGAACTTCAT

Full Affymetrix probeset data:

Annotations for 1640053_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720