FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640054_at:

>probe:Drosophila_2:1640054_at:369:589; Interrogation_Position=2644; Antisense; TGGATGCCCTGAAGATCGACCACGT
>probe:Drosophila_2:1640054_at:496:43; Interrogation_Position=2658; Antisense; ATCGACCACGTCTAGGCAGCAGGAT
>probe:Drosophila_2:1640054_at:491:565; Interrogation_Position=2672; Antisense; GGCAGCAGGATTGGCTTTACTTTAC
>probe:Drosophila_2:1640054_at:638:645; Interrogation_Position=2710; Antisense; TCATAACCTAGCCACATCCATATGT
>probe:Drosophila_2:1640054_at:15:681; Interrogation_Position=2730; Antisense; TATGTATCCACTTCCAATGCAGCTG
>probe:Drosophila_2:1640054_at:72:233; Interrogation_Position=2745; Antisense; AATGCAGCTGACACTGTCCGGAAAA
>probe:Drosophila_2:1640054_at:431:601; Interrogation_Position=2772; Antisense; TGTAGGCATGCCTCGAATTGCTCTC
>probe:Drosophila_2:1640054_at:586:247; Interrogation_Position=2787; Antisense; AATTGCTCTCTAGCTGGATCAGATT
>probe:Drosophila_2:1640054_at:702:539; Interrogation_Position=2815; Antisense; GGTTTATAGGCACTCCAGATTATTC
>probe:Drosophila_2:1640054_at:392:725; Interrogation_Position=2916; Antisense; TTGTTTTCCGTGTAATATCTCCCGT
>probe:Drosophila_2:1640054_at:62:241; Interrogation_Position=2929; Antisense; AATATCTCCCGTGCTTACTTAGAGT
>probe:Drosophila_2:1640054_at:3:659; Interrogation_Position=2976; Antisense; TAACGCCATTGGAGTTTCCATCTGG
>probe:Drosophila_2:1640054_at:559:1; Interrogation_Position=2989; Antisense; GTTTCCATCTGGTGGGCGGGACTAA
>probe:Drosophila_2:1640054_at:384:329; Interrogation_Position=3004; Antisense; GCGGGACTAAGAGACCACTTTGCAA

Paste this into a BLAST search page for me
TGGATGCCCTGAAGATCGACCACGTATCGACCACGTCTAGGCAGCAGGATGGCAGCAGGATTGGCTTTACTTTACTCATAACCTAGCCACATCCATATGTTATGTATCCACTTCCAATGCAGCTGAATGCAGCTGACACTGTCCGGAAAATGTAGGCATGCCTCGAATTGCTCTCAATTGCTCTCTAGCTGGATCAGATTGGTTTATAGGCACTCCAGATTATTCTTGTTTTCCGTGTAATATCTCCCGTAATATCTCCCGTGCTTACTTAGAGTTAACGCCATTGGAGTTTCCATCTGGGTTTCCATCTGGTGGGCGGGACTAAGCGGGACTAAGAGACCACTTTGCAA

Full Affymetrix probeset data:

Annotations for 1640054_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720