FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640055_at:

>probe:Drosophila_2:1640055_at:637:667; Interrogation_Position=2068; Antisense; TACTCAGCCTCTGCGGCGGAATGTA
>probe:Drosophila_2:1640055_at:328:601; Interrogation_Position=2089; Antisense; TGTATAAAGCAATGGGCGCCCTGAC
>probe:Drosophila_2:1640055_at:634:609; Interrogation_Position=2110; Antisense; TGACCAAAGACGGACGCGTGCGACT
>probe:Drosophila_2:1640055_at:545:405; Interrogation_Position=2131; Antisense; GACTGCCGCTGTCCAAGTTCGACAA
>probe:Drosophila_2:1640055_at:383:437; Interrogation_Position=2157; Antisense; GAGGAGATCCGCTACAACCGACGCT
>probe:Drosophila_2:1640055_at:388:313; Interrogation_Position=2213; Antisense; GCCAGTTTCGTACGCAGAGTTCAAA
>probe:Drosophila_2:1640055_at:293:177; Interrogation_Position=2237; Antisense; AAACGTCCGGGAGCACATGATGCGA
>probe:Drosophila_2:1640055_at:448:453; Interrogation_Position=2274; Antisense; GATCTATATACCTATGCGGCCAAGC
>probe:Drosophila_2:1640055_at:210:71; Interrogation_Position=2308; Antisense; AGGCCCGCAATGTTCTCGAAAGCAT
>probe:Drosophila_2:1640055_at:523:75; Interrogation_Position=2347; Antisense; AGGAGATGCTGGACCTCCTGCAAAT
>probe:Drosophila_2:1640055_at:616:297; Interrogation_Position=2363; Antisense; CCTGCAAATCGCACGGACTAACTTT
>probe:Drosophila_2:1640055_at:63:607; Interrogation_Position=2392; Antisense; TGATGAATGTGCTGGCTCGCGGTCA
>probe:Drosophila_2:1640055_at:302:207; Interrogation_Position=2430; Antisense; AAGCGGCAGCCAGAGTTCGACTTCT
>probe:Drosophila_2:1640055_at:279:91; Interrogation_Position=2443; Antisense; AGTTCGACTTCTCCAAACACAGCTA

Paste this into a BLAST search page for me
TACTCAGCCTCTGCGGCGGAATGTATGTATAAAGCAATGGGCGCCCTGACTGACCAAAGACGGACGCGTGCGACTGACTGCCGCTGTCCAAGTTCGACAAGAGGAGATCCGCTACAACCGACGCTGCCAGTTTCGTACGCAGAGTTCAAAAAACGTCCGGGAGCACATGATGCGAGATCTATATACCTATGCGGCCAAGCAGGCCCGCAATGTTCTCGAAAGCATAGGAGATGCTGGACCTCCTGCAAATCCTGCAAATCGCACGGACTAACTTTTGATGAATGTGCTGGCTCGCGGTCAAAGCGGCAGCCAGAGTTCGACTTCTAGTTCGACTTCTCCAAACACAGCTA

Full Affymetrix probeset data:

Annotations for 1640055_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720