FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640056_at:

>probe:Drosophila_2:1640056_at:391:83; Interrogation_Position=152; Antisense; AGTGATTTGGATGCCTTACGCGCGC
>probe:Drosophila_2:1640056_at:309:167; Interrogation_Position=189; Antisense; AAATGCAGTCGCAATTCGGCGGCGG
>probe:Drosophila_2:1640056_at:183:97; Interrogation_Position=249; Antisense; AGATGCGCGCCCAGGAGGAAATGAA
>probe:Drosophila_2:1640056_at:590:15; Interrogation_Position=283; Antisense; ATTATCCCAAGTTCTGGACCAGCAG
>probe:Drosophila_2:1640056_at:561:347; Interrogation_Position=304; Antisense; GCAGGCCAGGGCACGACTTAATACC
>probe:Drosophila_2:1640056_at:418:27; Interrogation_Position=324; Antisense; ATACCCTCAAAGTCAGCAAGCCGGA
>probe:Drosophila_2:1640056_at:20:603; Interrogation_Position=360; Antisense; TGTTCGAGAACATGGTCATCCGCAT
>probe:Drosophila_2:1640056_at:430:517; Interrogation_Position=405; Antisense; GTGGAAAACTTGATGACGCCCAGTT
>probe:Drosophila_2:1640056_at:155:497; Interrogation_Position=431; Antisense; GTCAGCATCCTCGAAAGCGTCAATG
>probe:Drosophila_2:1640056_at:628:99; Interrogation_Position=468; Antisense; AGAGCAAGTCCTCCGTGAAATACGA
>probe:Drosophila_2:1640056_at:101:137; Interrogation_Position=522; Antisense; ACGACGAGGATTACGGCTGCTGATT
>probe:Drosophila_2:1640056_at:77:671; Interrogation_Position=533; Antisense; TACGGCTGCTGATTCGTCCGAAATT
>probe:Drosophila_2:1640056_at:147:397; Interrogation_Position=552; Antisense; GAAATTCCGCCCAACATCTAATTTA
>probe:Drosophila_2:1640056_at:241:601; Interrogation_Position=568; Antisense; TCTAATTTAAGTTATGCCCGCTCCT

Paste this into a BLAST search page for me
AGTGATTTGGATGCCTTACGCGCGCAAATGCAGTCGCAATTCGGCGGCGGAGATGCGCGCCCAGGAGGAAATGAAATTATCCCAAGTTCTGGACCAGCAGGCAGGCCAGGGCACGACTTAATACCATACCCTCAAAGTCAGCAAGCCGGATGTTCGAGAACATGGTCATCCGCATGTGGAAAACTTGATGACGCCCAGTTGTCAGCATCCTCGAAAGCGTCAATGAGAGCAAGTCCTCCGTGAAATACGAACGACGAGGATTACGGCTGCTGATTTACGGCTGCTGATTCGTCCGAAATTGAAATTCCGCCCAACATCTAATTTATCTAATTTAAGTTATGCCCGCTCCT

Full Affymetrix probeset data:

Annotations for 1640056_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720