FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640057_at:

>probe:Drosophila_2:1640057_at:235:195; Interrogation_Position=1071; Antisense; AACTGAAGCTATTACTTTCCCACTC
>probe:Drosophila_2:1640057_at:372:157; Interrogation_Position=647; Antisense; ACAACTTCCCCAGTAATGGACTTGG
>probe:Drosophila_2:1640057_at:400:63; Interrogation_Position=662; Antisense; ATGGACTTGGCCTCAACCAATTTCC
>probe:Drosophila_2:1640057_at:588:17; Interrogation_Position=681; Antisense; ATTTCCTGGCAATGGGCAATACCCT
>probe:Drosophila_2:1640057_at:728:705; Interrogation_Position=705; Antisense; TTACGGCTCCTATCCAGGTGGCGAC
>probe:Drosophila_2:1640057_at:214:7; Interrogation_Position=728; Antisense; ACTTCGGTGGAAGCCAATTCGCGGG
>probe:Drosophila_2:1640057_at:309:349; Interrogation_Position=754; Antisense; GCAGGTGCCCAGTTCCCAGGATTGG
>probe:Drosophila_2:1640057_at:165:371; Interrogation_Position=779; Antisense; GACAGTACCCAGCAAACCAACAGTT
>probe:Drosophila_2:1640057_at:656:183; Interrogation_Position=797; Antisense; AACAGTTCGGTGGACCTCAGTACAC
>probe:Drosophila_2:1640057_at:182:407; Interrogation_Position=845; Antisense; GACTGGGCTTAGGTCAACTTGGAGT
>probe:Drosophila_2:1640057_at:637:89; Interrogation_Position=867; Antisense; AGTAGGCAACGGTGGACTCGGATAC
>probe:Drosophila_2:1640057_at:346:585; Interrogation_Position=894; Antisense; TGGAAGTTTTCCACCTCTAGGAGGA
>probe:Drosophila_2:1640057_at:421:165; Interrogation_Position=937; Antisense; AAATCGCCAGCTGTGGCCGATGGTA
>probe:Drosophila_2:1640057_at:727:657; Interrogation_Position=969; Antisense; TAAGAGTGTGGCAGCGTCACCCAGA

Paste this into a BLAST search page for me
AACTGAAGCTATTACTTTCCCACTCACAACTTCCCCAGTAATGGACTTGGATGGACTTGGCCTCAACCAATTTCCATTTCCTGGCAATGGGCAATACCCTTTACGGCTCCTATCCAGGTGGCGACACTTCGGTGGAAGCCAATTCGCGGGGCAGGTGCCCAGTTCCCAGGATTGGGACAGTACCCAGCAAACCAACAGTTAACAGTTCGGTGGACCTCAGTACACGACTGGGCTTAGGTCAACTTGGAGTAGTAGGCAACGGTGGACTCGGATACTGGAAGTTTTCCACCTCTAGGAGGAAAATCGCCAGCTGTGGCCGATGGTATAAGAGTGTGGCAGCGTCACCCAGA

Full Affymetrix probeset data:

Annotations for 1640057_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720