FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640058_at:

>probe:Drosophila_2:1640058_at:109:341; Interrogation_Position=1022; Antisense; GCTATTACTCAAACGATCTTAGACA
>probe:Drosophila_2:1640058_at:280:677; Interrogation_Position=1064; Antisense; TAGAGACTCCAAATATACTGACTGA
>probe:Drosophila_2:1640058_at:401:667; Interrogation_Position=1079; Antisense; TACTGACTGAGGCATTCAATGTTAA
>probe:Drosophila_2:1640058_at:503:429; Interrogation_Position=1116; Antisense; GAGTATTCCAATGCAGTTTTACCAT
>probe:Drosophila_2:1640058_at:51:349; Interrogation_Position=1128; Antisense; GCAGTTTTACCATACTTAAGCAACA
>probe:Drosophila_2:1640058_at:697:203; Interrogation_Position=1157; Antisense; AATCGTTTCACGTCTAAATGTAAAT
>probe:Drosophila_2:1640058_at:560:259; Interrogation_Position=626; Antisense; CACGTCGCTGCTGGAGGGTATATTC
>probe:Drosophila_2:1640058_at:720:31; Interrogation_Position=711; Antisense; ATCAACGGAATGTGCTGTCAACAGC
>probe:Drosophila_2:1640058_at:476:659; Interrogation_Position=761; Antisense; TAAGCTGAGCTGTGGCTACTTTCGC
>probe:Drosophila_2:1640058_at:714:325; Interrogation_Position=784; Antisense; GCGATGCCTTCGACTGTGTAGATAT
>probe:Drosophila_2:1640058_at:369:553; Interrogation_Position=813; Antisense; GGAGCAGAGCATCGACGCAACTGAA
>probe:Drosophila_2:1640058_at:438:373; Interrogation_Position=835; Antisense; GAAGATCGCAGTTCTCGGGTAGCAA
>probe:Drosophila_2:1640058_at:544:485; Interrogation_Position=853; Antisense; GTAGCAAAGCTCATTAAACCGAAGG
>probe:Drosophila_2:1640058_at:513:419; Interrogation_Position=985; Antisense; GAGCATTTGTATTTCTATAATCTGC

Paste this into a BLAST search page for me
GCTATTACTCAAACGATCTTAGACATAGAGACTCCAAATATACTGACTGATACTGACTGAGGCATTCAATGTTAAGAGTATTCCAATGCAGTTTTACCATGCAGTTTTACCATACTTAAGCAACAAATCGTTTCACGTCTAAATGTAAATCACGTCGCTGCTGGAGGGTATATTCATCAACGGAATGTGCTGTCAACAGCTAAGCTGAGCTGTGGCTACTTTCGCGCGATGCCTTCGACTGTGTAGATATGGAGCAGAGCATCGACGCAACTGAAGAAGATCGCAGTTCTCGGGTAGCAAGTAGCAAAGCTCATTAAACCGAAGGGAGCATTTGTATTTCTATAATCTGC

Full Affymetrix probeset data:

Annotations for 1640058_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720