FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640059_at:

>probe:Drosophila_2:1640059_at:242:413; Interrogation_Position=5247; Antisense; GACCGTTTACGACGAGTGTCATTTG
>probe:Drosophila_2:1640059_at:227:85; Interrogation_Position=5261; Antisense; AGTGTCATTTGATGTTCCTCGTCCG
>probe:Drosophila_2:1640059_at:672:301; Interrogation_Position=5283; Antisense; CCGCTCCACGGCCAAGATGATGAAC
>probe:Drosophila_2:1640059_at:632:97; Interrogation_Position=5318; Antisense; AGATCGTGTGCAACTACCAGCAGAT
>probe:Drosophila_2:1640059_at:409:445; Interrogation_Position=5340; Antisense; GATGAATGGATCTGCCAGCCAGGAT
>probe:Drosophila_2:1640059_at:213:79; Interrogation_Position=5360; Antisense; AGGATTAGTTCCACTCAGTCTGCTA
>probe:Drosophila_2:1640059_at:166:267; Interrogation_Position=5375; Antisense; CAGTCTGCTAGTTAAGCCTGCTCAA
>probe:Drosophila_2:1640059_at:161:397; Interrogation_Position=5443; Antisense; GACACTTAGTCCTTAGAGTCAACGA
>probe:Drosophila_2:1640059_at:610:21; Interrogation_Position=5471; Antisense; ATATCTTCTGAATTGCTCCATAAAA
>probe:Drosophila_2:1640059_at:460:687; Interrogation_Position=5516; Antisense; TATATCTATATCTTTGCCCAGCGTG
>probe:Drosophila_2:1640059_at:319:291; Interrogation_Position=5537; Antisense; CGTGCCAAATTGTTTCGCGCGGAAA
>probe:Drosophila_2:1640059_at:26:697; Interrogation_Position=5549; Antisense; TTTCGCGCGGAAATTGTCATGTAAA
>probe:Drosophila_2:1640059_at:338:703; Interrogation_Position=5662; Antisense; TTATATATCACTATTCGAGGACGAA
>probe:Drosophila_2:1640059_at:613:359; Interrogation_Position=5709; Antisense; GCAACTATCTATGGGTATGCCAACA

Paste this into a BLAST search page for me
GACCGTTTACGACGAGTGTCATTTGAGTGTCATTTGATGTTCCTCGTCCGCCGCTCCACGGCCAAGATGATGAACAGATCGTGTGCAACTACCAGCAGATGATGAATGGATCTGCCAGCCAGGATAGGATTAGTTCCACTCAGTCTGCTACAGTCTGCTAGTTAAGCCTGCTCAAGACACTTAGTCCTTAGAGTCAACGAATATCTTCTGAATTGCTCCATAAAATATATCTATATCTTTGCCCAGCGTGCGTGCCAAATTGTTTCGCGCGGAAATTTCGCGCGGAAATTGTCATGTAAATTATATATCACTATTCGAGGACGAAGCAACTATCTATGGGTATGCCAACA

Full Affymetrix probeset data:

Annotations for 1640059_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720