FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640060_at:

>probe:Drosophila_2:1640060_at:640:575; Interrogation_Position=1000; Antisense; TGGCTAAGGTGAAGGCTCCGGTTCT
>probe:Drosophila_2:1640060_at:155:613; Interrogation_Position=1009; Antisense; TGAAGGCTCCGGTTCTGGTTATCCA
>probe:Drosophila_2:1640060_at:694:715; Interrogation_Position=1021; Antisense; TTCTGGTTATCCACGGCACCGATGA
>probe:Drosophila_2:1640060_at:583:353; Interrogation_Position=1036; Antisense; GCACCGATGATGAGGTCATTGACTT
>probe:Drosophila_2:1640060_at:620:605; Interrogation_Position=1046; Antisense; TGAGGTCATTGACTTTTCCCATGGC
>probe:Drosophila_2:1640060_at:392:5; Interrogation_Position=1053; Antisense; ATTGACTTTTCCCATGGCATCGGAA
>probe:Drosophila_2:1640060_at:658:695; Interrogation_Position=1060; Antisense; TTTCCCATGGCATCGGAATCTACGA
>probe:Drosophila_2:1640060_at:476:41; Interrogation_Position=1071; Antisense; ATCGGAATCTACGAGCGGTGTCCTA
>probe:Drosophila_2:1640060_at:60:239; Interrogation_Position=1076; Antisense; AATCTACGAGCGGTGTCCTAAGACT
>probe:Drosophila_2:1640060_at:38:419; Interrogation_Position=1083; Antisense; GAGCGGTGTCCTAAGACTGTCGAGC
>probe:Drosophila_2:1640060_at:445:515; Interrogation_Position=1088; Antisense; GTGTCCTAAGACTGTCGAGCCGTTT
>probe:Drosophila_2:1640060_at:301:659; Interrogation_Position=1094; Antisense; TAAGACTGTCGAGCCGTTTTGGGTG
>probe:Drosophila_2:1640060_at:574:411; Interrogation_Position=975; Antisense; GACGCCTTTCCCAGCATTGATAAGG
>probe:Drosophila_2:1640060_at:553:719; Interrogation_Position=982; Antisense; TTCCCAGCATTGATAAGGTGGCTAA

Paste this into a BLAST search page for me
TGGCTAAGGTGAAGGCTCCGGTTCTTGAAGGCTCCGGTTCTGGTTATCCATTCTGGTTATCCACGGCACCGATGAGCACCGATGATGAGGTCATTGACTTTGAGGTCATTGACTTTTCCCATGGCATTGACTTTTCCCATGGCATCGGAATTTCCCATGGCATCGGAATCTACGAATCGGAATCTACGAGCGGTGTCCTAAATCTACGAGCGGTGTCCTAAGACTGAGCGGTGTCCTAAGACTGTCGAGCGTGTCCTAAGACTGTCGAGCCGTTTTAAGACTGTCGAGCCGTTTTGGGTGGACGCCTTTCCCAGCATTGATAAGGTTCCCAGCATTGATAAGGTGGCTAA

Full Affymetrix probeset data:

Annotations for 1640060_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720