FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640064_at:

>probe:Drosophila_2:1640064_at:232:221; Interrogation_Position=1607; Antisense; AAGTGGGCACCGTCCAGACGATACA
>probe:Drosophila_2:1640064_at:354:105; Interrogation_Position=1622; Antisense; AGACGATACAGCTGCGACCTTCACT
>probe:Drosophila_2:1640064_at:413:331; Interrogation_Position=1684; Antisense; GCGGCACCTGGCAAGACAATCGTCA
>probe:Drosophila_2:1640064_at:366:395; Interrogation_Position=1728; Antisense; GAAATCTCCGAACGTGATGCCGCTG
>probe:Drosophila_2:1640064_at:115:51; Interrogation_Position=1744; Antisense; ATGCCGCTGCTAACTTCTTCTGAGA
>probe:Drosophila_2:1640064_at:478:661; Interrogation_Position=1754; Antisense; TAACTTCTTCTGAGATCTGTCGCCA
>probe:Drosophila_2:1640064_at:303:117; Interrogation_Position=1778; Antisense; AGCTTCACGAGTTGCGGCGTCAAAA
>probe:Drosophila_2:1640064_at:450:577; Interrogation_Position=1821; Antisense; GGCCGACTCCTTTCAGCGGGAAAAG
>probe:Drosophila_2:1640064_at:338:5; Interrogation_Position=1864; Antisense; ATTGACCGCCTGGAGCAGATGGTGC
>probe:Drosophila_2:1640064_at:720:543; Interrogation_Position=1981; Antisense; GGATATTCAGCCGATAAGTGCATTT
>probe:Drosophila_2:1640064_at:629:169; Interrogation_Position=2008; Antisense; AAAGCACCCAGTTTAATGACGATTT
>probe:Drosophila_2:1640064_at:401:609; Interrogation_Position=2024; Antisense; TGACGATTTCATACCATTTCTTATC
>probe:Drosophila_2:1640064_at:7:425; Interrogation_Position=2074; Antisense; GAGAGCTTTAAACCAATTCGGATGT
>probe:Drosophila_2:1640064_at:297:17; Interrogation_Position=2127; Antisense; ATTTTCAATCCATAATCTGCACAAG

Paste this into a BLAST search page for me
AAGTGGGCACCGTCCAGACGATACAAGACGATACAGCTGCGACCTTCACTGCGGCACCTGGCAAGACAATCGTCAGAAATCTCCGAACGTGATGCCGCTGATGCCGCTGCTAACTTCTTCTGAGATAACTTCTTCTGAGATCTGTCGCCAAGCTTCACGAGTTGCGGCGTCAAAAGGCCGACTCCTTTCAGCGGGAAAAGATTGACCGCCTGGAGCAGATGGTGCGGATATTCAGCCGATAAGTGCATTTAAAGCACCCAGTTTAATGACGATTTTGACGATTTCATACCATTTCTTATCGAGAGCTTTAAACCAATTCGGATGTATTTTCAATCCATAATCTGCACAAG

Full Affymetrix probeset data:

Annotations for 1640064_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720