Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640065_at:

>probe:Drosophila_2:1640065_at:487:257; Interrogation_Position=191; Antisense; CACGGTGCCCACGTTGGAGGACGAT
>probe:Drosophila_2:1640065_at:256:23; Interrogation_Position=223; Antisense; ATATCTGGGACTCACATGCCATTAT
>probe:Drosophila_2:1640065_at:254:557; Interrogation_Position=278; Antisense; GGACAGTCTCTATCCGAAAGATCTC
>probe:Drosophila_2:1640065_at:532:85; Interrogation_Position=340; Antisense; AGTCCGGAGTGATCTTCGCTAATGC
>probe:Drosophila_2:1640065_at:237:377; Interrogation_Position=370; Antisense; GAAGCATTACCAAGCCACTTTTCGC
>probe:Drosophila_2:1640065_at:695:723; Interrogation_Position=439; Antisense; TTGAGGTCTATGACTTCCTGGAGAA
>probe:Drosophila_2:1640065_at:284:585; Interrogation_Position=473; Antisense; TGGAAATGACTACGTCGCCGGCAAT
>probe:Drosophila_2:1640065_at:483:35; Interrogation_Position=496; Antisense; ATCAGCTTACGATTGCCGACTTTAG
>probe:Drosophila_2:1640065_at:469:483; Interrogation_Position=520; Antisense; GTATCATATCAACTGTGTCCTCGTT
>probe:Drosophila_2:1640065_at:396:533; Interrogation_Position=560; Antisense; GGTGGACACGACCAAATATCCTCGG
>probe:Drosophila_2:1640065_at:494:23; Interrogation_Position=575; Antisense; ATATCCTCGGATAGCTGCATGGTTC
>probe:Drosophila_2:1640065_at:360:213; Interrogation_Position=600; Antisense; AAGAGACTCCAAAAGCTGCCCTACT
>probe:Drosophila_2:1640065_at:432:535; Interrogation_Position=645; Antisense; GGTGCTCGTACATTTGAGTCCTTCA
>probe:Drosophila_2:1640065_at:75:431; Interrogation_Position=675; Antisense; GAGTATAATTTCACTTTCGCATCGA

Paste this into a BLAST search page for me
CACGGTGCCCACGTTGGAGGACGATATATCTGGGACTCACATGCCATTATGGACAGTCTCTATCCGAAAGATCTCAGTCCGGAGTGATCTTCGCTAATGCGAAGCATTACCAAGCCACTTTTCGCTTGAGGTCTATGACTTCCTGGAGAATGGAAATGACTACGTCGCCGGCAATATCAGCTTACGATTGCCGACTTTAGGTATCATATCAACTGTGTCCTCGTTGGTGGACACGACCAAATATCCTCGGATATCCTCGGATAGCTGCATGGTTCAAGAGACTCCAAAAGCTGCCCTACTGGTGCTCGTACATTTGAGTCCTTCAGAGTATAATTTCACTTTCGCATCGA

Full Affymetrix probeset data:

Annotations for 1640065_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime