FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640067_at:

>probe:Drosophila_2:1640067_at:680:535; Interrogation_Position=283; Antisense; GGTCCTTCCGATTCTGTTCATAACA
>probe:Drosophila_2:1640067_at:141:483; Interrogation_Position=318; Antisense; GTATACTTAAGGTTGGCGCCATGAT
>probe:Drosophila_2:1640067_at:596:269; Interrogation_Position=337; Antisense; CATGATCCGCCTGGCATTGGTGAAG
>probe:Drosophila_2:1640067_at:494:73; Interrogation_Position=360; Antisense; AGGACGATGTGTTCTTTACCAAGGA
>probe:Drosophila_2:1640067_at:133:705; Interrogation_Position=375; Antisense; TTACCAAGGATTCGGCATACTATAT
>probe:Drosophila_2:1640067_at:297:729; Interrogation_Position=404; Antisense; TTGGAGACACGCAAAGGTCCCTGGT
>probe:Drosophila_2:1640067_at:78:537; Interrogation_Position=419; Antisense; GGTCCCTGGTACAAGCAAAAGAGTC
>probe:Drosophila_2:1640067_at:341:605; Interrogation_Position=469; Antisense; TGATATGCCACCAGGATTGCTCTTG
>probe:Drosophila_2:1640067_at:514:7; Interrogation_Position=484; Antisense; ATTGCTCTTGGCCAACCAGGGCGAT
>probe:Drosophila_2:1640067_at:143:81; Interrogation_Position=501; Antisense; AGGGCGATGTTTCTGGTCCTTCATT
>probe:Drosophila_2:1640067_at:182:505; Interrogation_Position=516; Antisense; GTCCTTCATTCTAGGAGGCGTTGAA
>probe:Drosophila_2:1640067_at:644:53; Interrogation_Position=608; Antisense; ATGCAGTGATCACAGGCGTGGCTTT
>probe:Drosophila_2:1640067_at:668:329; Interrogation_Position=623; Antisense; GCGTGGCTTTGGGTTTGGCAACAAT
>probe:Drosophila_2:1640067_at:442:417; Interrogation_Position=669; Antisense; GAGCTGTCCCCTTTTATTGTAGGCT

Paste this into a BLAST search page for me
GGTCCTTCCGATTCTGTTCATAACAGTATACTTAAGGTTGGCGCCATGATCATGATCCGCCTGGCATTGGTGAAGAGGACGATGTGTTCTTTACCAAGGATTACCAAGGATTCGGCATACTATATTTGGAGACACGCAAAGGTCCCTGGTGGTCCCTGGTACAAGCAAAAGAGTCTGATATGCCACCAGGATTGCTCTTGATTGCTCTTGGCCAACCAGGGCGATAGGGCGATGTTTCTGGTCCTTCATTGTCCTTCATTCTAGGAGGCGTTGAAATGCAGTGATCACAGGCGTGGCTTTGCGTGGCTTTGGGTTTGGCAACAATGAGCTGTCCCCTTTTATTGTAGGCT

Full Affymetrix probeset data:

Annotations for 1640067_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720