FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640069_at:

>probe:Drosophila_2:1640069_at:324:629; Interrogation_Position=132; Antisense; TCCTTAGGCGCTTTCACATTCAAAA
>probe:Drosophila_2:1640069_at:484:207; Interrogation_Position=224; Antisense; AAGCTGGATGCTTCAGAACCTTTCA
>probe:Drosophila_2:1640069_at:661:379; Interrogation_Position=239; Antisense; GAACCTTTCAAGACGGAGGCCACCA
>probe:Drosophila_2:1640069_at:141:181; Interrogation_Position=274; Antisense; AAACAAGCTGCACGCCATGGGAGTT
>probe:Drosophila_2:1640069_at:211:591; Interrogation_Position=291; Antisense; TGGGAGTTTCCAATGATCAGCTTAC
>probe:Drosophila_2:1640069_at:126:649; Interrogation_Position=307; Antisense; TCAGCTTACTTTGGAAACGGCGGCC
>probe:Drosophila_2:1640069_at:451:497; Interrogation_Position=360; Antisense; GTCGTCTACCCGTGATCATGGTGAA
>probe:Drosophila_2:1640069_at:427:61; Interrogation_Position=392; Antisense; ATGTCGGAGCACCTGAAAGCGGCCA
>probe:Drosophila_2:1640069_at:595:391; Interrogation_Position=406; Antisense; GAAAGCGGCCACAGACCTCATAGAG
>probe:Drosophila_2:1640069_at:230:497; Interrogation_Position=435; Antisense; GTCATGTGCGTGTTGGTCCGGAAAT
>probe:Drosophila_2:1640069_at:285:13; Interrogation_Position=461; Antisense; ATTAAGGATCCTGCTTTTCTGGTCT
>probe:Drosophila_2:1640069_at:576:391; Interrogation_Position=489; Antisense; GAAACCTCGAGGACTTTGTCACCTG
>probe:Drosophila_2:1640069_at:671:721; Interrogation_Position=504; Antisense; TTGTCACCTGGGTGGATGGCTCCAA
>probe:Drosophila_2:1640069_at:138:421; Interrogation_Position=585; Antisense; GAGACTACCTCCCTTAAGATAACCA

Paste this into a BLAST search page for me
TCCTTAGGCGCTTTCACATTCAAAAAAGCTGGATGCTTCAGAACCTTTCAGAACCTTTCAAGACGGAGGCCACCAAAACAAGCTGCACGCCATGGGAGTTTGGGAGTTTCCAATGATCAGCTTACTCAGCTTACTTTGGAAACGGCGGCCGTCGTCTACCCGTGATCATGGTGAAATGTCGGAGCACCTGAAAGCGGCCAGAAAGCGGCCACAGACCTCATAGAGGTCATGTGCGTGTTGGTCCGGAAATATTAAGGATCCTGCTTTTCTGGTCTGAAACCTCGAGGACTTTGTCACCTGTTGTCACCTGGGTGGATGGCTCCAAGAGACTACCTCCCTTAAGATAACCA

Full Affymetrix probeset data:

Annotations for 1640069_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720