FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640073_at:

>probe:Drosophila_2:1640073_at:107:569; Interrogation_Position=157; Antisense; GGCGACGAACAGACCACTTGCAATG
>probe:Drosophila_2:1640073_at:422:63; Interrogation_Position=179; Antisense; ATGTGACCATTGTGAACCTATCCCT
>probe:Drosophila_2:1640073_at:81:131; Interrogation_Position=194; Antisense; ACCTATCCCTGTGCATGGACATTGA
>probe:Drosophila_2:1640073_at:711:1; Interrogation_Position=21; Antisense; ATTGGCTCCTTGCTTTACTGTGGGC
>probe:Drosophila_2:1640073_at:463:261; Interrogation_Position=256; Antisense; CAGCCAGAACCGATTGATTTGCCCA
>probe:Drosophila_2:1640073_at:718:459; Interrogation_Position=271; Antisense; GATTTGCCCATGATCCGAGAACGAT
>probe:Drosophila_2:1640073_at:595:321; Interrogation_Position=354; Antisense; GCCCTTTGGTCAAGCTCTGTTCAGA
>probe:Drosophila_2:1640073_at:169:513; Interrogation_Position=398; Antisense; GTGATCCCGCTATCATCTGGCAGAA
>probe:Drosophila_2:1640073_at:1:519; Interrogation_Position=40; Antisense; GTGGGCTCTATTGTGCGCTGCAAGA
>probe:Drosophila_2:1640073_at:580:575; Interrogation_Position=438; Antisense; GGCGATCAATATACTCCGTCAGGTG
>probe:Drosophila_2:1640073_at:126:81; Interrogation_Position=458; Antisense; AGGTGGTCATCGATGCGCCGTATGC
>probe:Drosophila_2:1640073_at:713:45; Interrogation_Position=493; Antisense; ATCCGATACCTCGATTGGAATCCCA
>probe:Drosophila_2:1640073_at:646:367; Interrogation_Position=510; Antisense; GAATCCCAAGCTGGCGATATGCGTC
>probe:Drosophila_2:1640073_at:12:457; Interrogation_Position=525; Antisense; GATATGCGTCCAAGAGGTCGTTCAA

Paste this into a BLAST search page for me
GGCGACGAACAGACCACTTGCAATGATGTGACCATTGTGAACCTATCCCTACCTATCCCTGTGCATGGACATTGAATTGGCTCCTTGCTTTACTGTGGGCCAGCCAGAACCGATTGATTTGCCCAGATTTGCCCATGATCCGAGAACGATGCCCTTTGGTCAAGCTCTGTTCAGAGTGATCCCGCTATCATCTGGCAGAAGTGGGCTCTATTGTGCGCTGCAAGAGGCGATCAATATACTCCGTCAGGTGAGGTGGTCATCGATGCGCCGTATGCATCCGATACCTCGATTGGAATCCCAGAATCCCAAGCTGGCGATATGCGTCGATATGCGTCCAAGAGGTCGTTCAA

Full Affymetrix probeset data:

Annotations for 1640073_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720