FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640076_at:

>probe:Drosophila_2:1640076_at:513:413; Interrogation_Position=13; Antisense; GACCTCAACTGAGTATCAATCCTAT
>probe:Drosophila_2:1640076_at:629:153; Interrogation_Position=219; Antisense; ACAGCCCAATGAATCGGAGGTTCAG
>probe:Drosophila_2:1640076_at:486:249; Interrogation_Position=225; Antisense; CAATGAATCGGAGGTTCAGTCCATG
>probe:Drosophila_2:1640076_at:347:429; Interrogation_Position=23; Antisense; GAGTATCAATCCTATCGAAAAAGTA
>probe:Drosophila_2:1640076_at:234:309; Interrogation_Position=245; Antisense; CCATGATAAACGAGGTGGACTCTGA
>probe:Drosophila_2:1640076_at:114:81; Interrogation_Position=257; Antisense; AGGTGGACTCTGATGGAAACGGATC
>probe:Drosophila_2:1640076_at:73:67; Interrogation_Position=269; Antisense; ATGGAAACGGATCCATTGCAAAGGA
>probe:Drosophila_2:1640076_at:623:151; Interrogation_Position=524; Antisense; ACATGATGACCACGCGTTAATCTAC
>probe:Drosophila_2:1640076_at:341:607; Interrogation_Position=527; Antisense; TGATGACCACGCGTTAATCTACACG
>probe:Drosophila_2:1640076_at:92:711; Interrogation_Position=540; Antisense; TTAATCTACACGCACACGCTTTCTA
>probe:Drosophila_2:1640076_at:320:157; Interrogation_Position=547; Antisense; ACACGCACACGCTTTCTAAATTACA
>probe:Drosophila_2:1640076_at:558:297; Interrogation_Position=550; Antisense; CGCACACGCTTTCTAAATTACAATC
>probe:Drosophila_2:1640076_at:341:239; Interrogation_Position=61; Antisense; AATAATAATATTCTCCTTCCCATAA
>probe:Drosophila_2:1640076_at:554:689; Interrogation_Position=69; Antisense; TATTCTCCTTCCCATAATATAAAGC

Paste this into a BLAST search page for me
GACCTCAACTGAGTATCAATCCTATACAGCCCAATGAATCGGAGGTTCAGCAATGAATCGGAGGTTCAGTCCATGGAGTATCAATCCTATCGAAAAAGTACCATGATAAACGAGGTGGACTCTGAAGGTGGACTCTGATGGAAACGGATCATGGAAACGGATCCATTGCAAAGGAACATGATGACCACGCGTTAATCTACTGATGACCACGCGTTAATCTACACGTTAATCTACACGCACACGCTTTCTAACACGCACACGCTTTCTAAATTACACGCACACGCTTTCTAAATTACAATCAATAATAATATTCTCCTTCCCATAATATTCTCCTTCCCATAATATAAAGC

Full Affymetrix probeset data:

Annotations for 1640076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720