Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640077_at:

>probe:Drosophila_2:1640077_at:145:717; Interrogation_Position=2101; Antisense; TTCGTTTCGGCCGTCATCCATCTGA
>probe:Drosophila_2:1640077_at:523:131; Interrogation_Position=2128; Antisense; ACCGCGTTCAATCAGTTCCATTTGA
>probe:Drosophila_2:1640077_at:202:629; Interrogation_Position=2144; Antisense; TCCATTTGAAGAACTACGGGCAGGT
>probe:Drosophila_2:1640077_at:470:513; Interrogation_Position=2173; Antisense; GTGATCGAGGTGCATCTGCACGACT
>probe:Drosophila_2:1640077_at:283:355; Interrogation_Position=2190; Antisense; GCACGACTGGATCAAGAGCATACTG
>probe:Drosophila_2:1640077_at:101:669; Interrogation_Position=2210; Antisense; TACTGAGCTGCTAAAAACCCGCACT
>probe:Drosophila_2:1640077_at:638:297; Interrogation_Position=2229; Antisense; CGCACTCCACTGAATTTCTAACTAC
>probe:Drosophila_2:1640077_at:591:603; Interrogation_Position=2332; Antisense; TGTTGATGATGCTGATCTGCCAATC
>probe:Drosophila_2:1640077_at:81:255; Interrogation_Position=2356; Antisense; CAAAAAGCCAGTTTCGCTCGAAAGA
>probe:Drosophila_2:1640077_at:704:561; Interrogation_Position=2469; Antisense; GGAACTATAGCTTTCTTTCTGAGGC
>probe:Drosophila_2:1640077_at:434:675; Interrogation_Position=2494; Antisense; TAGAAAATCCCCTCTGCGGCTTAAA
>probe:Drosophila_2:1640077_at:391:331; Interrogation_Position=2509; Antisense; GCGGCTTAAACCCATGACAATATCT
>probe:Drosophila_2:1640077_at:588:327; Interrogation_Position=2587; Antisense; GCGATTGCAGACTTTTATGTACTAC
>probe:Drosophila_2:1640077_at:203:575; Interrogation_Position=2669; Antisense; GGCGAGACGTGTTCAGAGTATTTTC

Paste this into a BLAST search page for me
TTCGTTTCGGCCGTCATCCATCTGAACCGCGTTCAATCAGTTCCATTTGATCCATTTGAAGAACTACGGGCAGGTGTGATCGAGGTGCATCTGCACGACTGCACGACTGGATCAAGAGCATACTGTACTGAGCTGCTAAAAACCCGCACTCGCACTCCACTGAATTTCTAACTACTGTTGATGATGCTGATCTGCCAATCCAAAAAGCCAGTTTCGCTCGAAAGAGGAACTATAGCTTTCTTTCTGAGGCTAGAAAATCCCCTCTGCGGCTTAAAGCGGCTTAAACCCATGACAATATCTGCGATTGCAGACTTTTATGTACTACGGCGAGACGTGTTCAGAGTATTTTC

Full Affymetrix probeset data:

Annotations for 1640077_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime