FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640078_at:

>probe:Drosophila_2:1640078_at:95:181; Interrogation_Position=119; Antisense; AAAAGAACACGCATTTACCTCCGCA
>probe:Drosophila_2:1640078_at:62:431; Interrogation_Position=198; Antisense; GAGTACTCTTTGAGGACATCTTCAA
>probe:Drosophila_2:1640078_at:187:355; Interrogation_Position=246; Antisense; GCAAAAAGTTCGACCGTGTATCCCG
>probe:Drosophila_2:1640078_at:360:617; Interrogation_Position=273; Antisense; TGCACTGCGAGTCCGAGTCGTTTAA
>probe:Drosophila_2:1640078_at:730:475; Interrogation_Position=292; Antisense; GTTTAAGATGGACCTCATCCTGGAC
>probe:Drosophila_2:1640078_at:522:47; Interrogation_Position=308; Antisense; ATCCTGGACATCAACTCGTGGCTAT
>probe:Drosophila_2:1640078_at:343:565; Interrogation_Position=327; Antisense; GGCTATACCCCATGGAGCTGGGCGA
>probe:Drosophila_2:1640078_at:610:409; Interrogation_Position=494; Antisense; GACGAAGCACACAATGAGGCCTCCC
>probe:Drosophila_2:1640078_at:287:279; Interrogation_Position=529; Antisense; CTACGTGTCATTCGGCGGCTTGCTG
>probe:Drosophila_2:1640078_at:289:343; Interrogation_Position=546; Antisense; GCTTGCTGATGCGACTTCAGGGTGA
>probe:Drosophila_2:1640078_at:607:647; Interrogation_Position=562; Antisense; TCAGGGTGACGCCAACAATCTTCAT
>probe:Drosophila_2:1640078_at:290:249; Interrogation_Position=577; Antisense; CAATCTTCATGGCTTCGAGGTGGAC
>probe:Drosophila_2:1640078_at:17:153; Interrogation_Position=606; Antisense; ACATGTACCTGCTGATGAAGCGGCT
>probe:Drosophila_2:1640078_at:389:285; Interrogation_Position=629; Antisense; CTGGCCTTCTGAATTTTCTACCTAA

Paste this into a BLAST search page for me
AAAAGAACACGCATTTACCTCCGCAGAGTACTCTTTGAGGACATCTTCAAGCAAAAAGTTCGACCGTGTATCCCGTGCACTGCGAGTCCGAGTCGTTTAAGTTTAAGATGGACCTCATCCTGGACATCCTGGACATCAACTCGTGGCTATGGCTATACCCCATGGAGCTGGGCGAGACGAAGCACACAATGAGGCCTCCCCTACGTGTCATTCGGCGGCTTGCTGGCTTGCTGATGCGACTTCAGGGTGATCAGGGTGACGCCAACAATCTTCATCAATCTTCATGGCTTCGAGGTGGACACATGTACCTGCTGATGAAGCGGCTCTGGCCTTCTGAATTTTCTACCTAA

Full Affymetrix probeset data:

Annotations for 1640078_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720