FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640079_at:

>probe:Drosophila_2:1640079_at:508:285; Interrogation_Position=350; Antisense; CCGACTACATTTGCCAGCGTTTGAA
>probe:Drosophila_2:1640079_at:615:55; Interrogation_Position=392; Antisense; ATGAGCTGCGGGTGCTACTGGTCCA
>probe:Drosophila_2:1640079_at:226:415; Interrogation_Position=430; Antisense; GAGCCAAACAATGCCCTCAAGAGCT
>probe:Drosophila_2:1640079_at:54:79; Interrogation_Position=460; Antisense; AGGATATCACTGTTAGCCGACCTGA
>probe:Drosophila_2:1640079_at:20:397; Interrogation_Position=483; Antisense; GACAATGATGTTGGCCTGGAACGCT
>probe:Drosophila_2:1640079_at:393:179; Interrogation_Position=538; Antisense; AAACAGTTCGAGAAGCGTCCGCCAG
>probe:Drosophila_2:1640079_at:685:377; Interrogation_Position=549; Antisense; GAAGCGTCCGCCAGATTTGATCATG
>probe:Drosophila_2:1640079_at:607:549; Interrogation_Position=582; Antisense; GGAGTCTAATCCACACCAGAAGCTA
>probe:Drosophila_2:1640079_at:452:511; Interrogation_Position=634; Antisense; GTGAACAAGACTGATGCTGCCGCCT
>probe:Drosophila_2:1640079_at:460:129; Interrogation_Position=667; Antisense; ACCTTTGGCAACCTGGGCAACATAA
>probe:Drosophila_2:1640079_at:560:587; Interrogation_Position=731; Antisense; TGGGTCCCCGGAAGGCCAAGAAGCT
>probe:Drosophila_2:1640079_at:682:561; Interrogation_Position=771; Antisense; GGAACCGTTCCTCAGCAAATAGCAA
>probe:Drosophila_2:1640079_at:60:531; Interrogation_Position=805; Antisense; GGTGTAATGCATCCCATAATCGTGT
>probe:Drosophila_2:1640079_at:625:513; Interrogation_Position=826; Antisense; GTGTATGACACACTTCATCCATCAT

Paste this into a BLAST search page for me
CCGACTACATTTGCCAGCGTTTGAAATGAGCTGCGGGTGCTACTGGTCCAGAGCCAAACAATGCCCTCAAGAGCTAGGATATCACTGTTAGCCGACCTGAGACAATGATGTTGGCCTGGAACGCTAAACAGTTCGAGAAGCGTCCGCCAGGAAGCGTCCGCCAGATTTGATCATGGGAGTCTAATCCACACCAGAAGCTAGTGAACAAGACTGATGCTGCCGCCTACCTTTGGCAACCTGGGCAACATAATGGGTCCCCGGAAGGCCAAGAAGCTGGAACCGTTCCTCAGCAAATAGCAAGGTGTAATGCATCCCATAATCGTGTGTGTATGACACACTTCATCCATCAT

Full Affymetrix probeset data:

Annotations for 1640079_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720