FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640080_at:

>probe:Drosophila_2:1640080_at:52:579; Interrogation_Position=1127; Antisense; GGCCAAAAACCGGTCAATACTCATT
>probe:Drosophila_2:1640080_at:259:241; Interrogation_Position=1142; Antisense; AATACTCATTTCGACGGACGTGGCG
>probe:Drosophila_2:1640080_at:325:9; Interrogation_Position=1182; Antisense; ATTCCTCATGTGGATGTCGTCGTTA
>probe:Drosophila_2:1640080_at:161:475; Interrogation_Position=1203; Antisense; GTTAATTTCGACATACCAACGCACA
>probe:Drosophila_2:1640080_at:676:255; Interrogation_Position=1229; Antisense; CAAAGACTACATTCACCGCGTGGGA
>probe:Drosophila_2:1640080_at:184:421; Interrogation_Position=1264; Antisense; GAGCAGGTCGCTCCGGCAAAGCCAT
>probe:Drosophila_2:1640080_at:454:173; Interrogation_Position=1281; Antisense; AAAGCCATAACCCTCGTGAGCCAGT
>probe:Drosophila_2:1640080_at:222:513; Interrogation_Position=1296; Antisense; GTGAGCCAGTACGACATTGAGTTGT
>probe:Drosophila_2:1640080_at:222:467; Interrogation_Position=1316; Antisense; GTTGTATCAGCGCATCGAACATCTA
>probe:Drosophila_2:1640080_at:284:533; Interrogation_Position=1382; Antisense; GGTGATGGCCCTTCAAGAACGAGTA
>probe:Drosophila_2:1640080_at:452:199; Interrogation_Position=1399; Antisense; AACGAGTAGCCGAAGCACAGCGCAC
>probe:Drosophila_2:1640080_at:89:527; Interrogation_Position=1480; Antisense; GGGACACCCACGATGATTCGGAGAA
>probe:Drosophila_2:1640080_at:71:463; Interrogation_Position=1494; Antisense; GATTCGGAGAACTTCACGGGCGCAC
>probe:Drosophila_2:1640080_at:717:455; Interrogation_Position=1606; Antisense; GATAGGTCAGATCAGTCTCGATTTT

Paste this into a BLAST search page for me
GGCCAAAAACCGGTCAATACTCATTAATACTCATTTCGACGGACGTGGCGATTCCTCATGTGGATGTCGTCGTTAGTTAATTTCGACATACCAACGCACACAAAGACTACATTCACCGCGTGGGAGAGCAGGTCGCTCCGGCAAAGCCATAAAGCCATAACCCTCGTGAGCCAGTGTGAGCCAGTACGACATTGAGTTGTGTTGTATCAGCGCATCGAACATCTAGGTGATGGCCCTTCAAGAACGAGTAAACGAGTAGCCGAAGCACAGCGCACGGGACACCCACGATGATTCGGAGAAGATTCGGAGAACTTCACGGGCGCACGATAGGTCAGATCAGTCTCGATTTT

Full Affymetrix probeset data:

Annotations for 1640080_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720