Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640082_at:

>probe:Drosophila_2:1640082_at:188:715; Interrogation_Position=3403; Antisense; TTGTGAGCAGTTTACCTTAGGCGAT
>probe:Drosophila_2:1640082_at:123:243; Interrogation_Position=3531; Antisense; AATATCTGTGTTTCCGTGTGTGAGT
>probe:Drosophila_2:1640082_at:423:711; Interrogation_Position=3542; Antisense; TTCCGTGTGTGAGTGTTACAACCGA
>probe:Drosophila_2:1640082_at:630:473; Interrogation_Position=3556; Antisense; GTTACAACCGAAACAGGCGAAGTAT
>probe:Drosophila_2:1640082_at:273:481; Interrogation_Position=3630; Antisense; GTAGTTAAACCGTGACAGCAAAGTA
>probe:Drosophila_2:1640082_at:199:113; Interrogation_Position=3681; Antisense; AGCACTCAAGCAATTTCCACATATA
>probe:Drosophila_2:1640082_at:629:563; Interrogation_Position=3729; Antisense; GGAATGTTAATAATGCCAGGCGGCA
>probe:Drosophila_2:1640082_at:122:315; Interrogation_Position=3743; Antisense; GCCAGGCGGCATAGAGATTTATTTT
>probe:Drosophila_2:1640082_at:606:359; Interrogation_Position=3773; Antisense; GCAACTACTTTGCTCTGCGTTATGT
>probe:Drosophila_2:1640082_at:130:483; Interrogation_Position=3832; Antisense; GTATTATTTATGTAGCAGCGGTCTT
>probe:Drosophila_2:1640082_at:560:485; Interrogation_Position=3843; Antisense; GTAGCAGCGGTCTTTGTATATAAAC
>probe:Drosophila_2:1640082_at:240:187; Interrogation_Position=3892; Antisense; AACAACGCGCAATTAGCAAATGAGA
>probe:Drosophila_2:1640082_at:570:403; Interrogation_Position=3915; Antisense; GACTTTTTCGATGAATGTCAAGGCA
>probe:Drosophila_2:1640082_at:162:225; Interrogation_Position=3934; Antisense; AAGGCATTAGCTGAACGTTTTGTAA

Paste this into a BLAST search page for me
TTGTGAGCAGTTTACCTTAGGCGATAATATCTGTGTTTCCGTGTGTGAGTTTCCGTGTGTGAGTGTTACAACCGAGTTACAACCGAAACAGGCGAAGTATGTAGTTAAACCGTGACAGCAAAGTAAGCACTCAAGCAATTTCCACATATAGGAATGTTAATAATGCCAGGCGGCAGCCAGGCGGCATAGAGATTTATTTTGCAACTACTTTGCTCTGCGTTATGTGTATTATTTATGTAGCAGCGGTCTTGTAGCAGCGGTCTTTGTATATAAACAACAACGCGCAATTAGCAAATGAGAGACTTTTTCGATGAATGTCAAGGCAAAGGCATTAGCTGAACGTTTTGTAA

Full Affymetrix probeset data:

Annotations for 1640082_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime