FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640085_at:

>probe:Drosophila_2:1640085_at:479:213; Interrogation_Position=1046; Antisense; AAGATGGCCCGCAGTGCTGTGAAGC
>probe:Drosophila_2:1640085_at:15:537; Interrogation_Position=1081; Antisense; GGTCAACTACGTGGATCCAGCCAAA
>probe:Drosophila_2:1640085_at:376:167; Interrogation_Position=1103; Antisense; AAATGCCGCCAGAGATTCTCGCAGA
>probe:Drosophila_2:1640085_at:120:225; Interrogation_Position=1178; Antisense; AAGGACAGTTGCGACGGAGACTCCG
>probe:Drosophila_2:1640085_at:588:51; Interrogation_Position=1214; Antisense; ATGCGATTCCGCGACGAGTCCTGGG
>probe:Drosophila_2:1640085_at:682:433; Interrogation_Position=1244; Antisense; GAGGGCATCGTATCATTCGGCTACA
>probe:Drosophila_2:1640085_at:456:273; Interrogation_Position=1257; Antisense; CATTCGGCTACAAGTGCGGACTGAA
>probe:Drosophila_2:1640085_at:562:431; Interrogation_Position=1293; Antisense; GAGTCTACACGAACGTGGCTGCCTA
>probe:Drosophila_2:1640085_at:436:581; Interrogation_Position=1308; Antisense; TGGCTGCCTACGACATCTGGATCAG
>probe:Drosophila_2:1640085_at:111:571; Interrogation_Position=1345; Antisense; GGCTTAGGTCCCGAATTCAAACTGA
>probe:Drosophila_2:1640085_at:473:239; Interrogation_Position=896; Antisense; AATCAGGTGCACGACATTGGTCTCA
>probe:Drosophila_2:1640085_at:289:5; Interrogation_Position=911; Antisense; ATTGGTCTCATTCGCATGGAGCGCA
>probe:Drosophila_2:1640085_at:242:669; Interrogation_Position=944; Antisense; TACTCGGACAACATTCAGCCCATTT
>probe:Drosophila_2:1640085_at:2:89; Interrogation_Position=993; Antisense; AGTCGAGGCAATCCGGCCAGCAGTT

Paste this into a BLAST search page for me
AAGATGGCCCGCAGTGCTGTGAAGCGGTCAACTACGTGGATCCAGCCAAAAAATGCCGCCAGAGATTCTCGCAGAAAGGACAGTTGCGACGGAGACTCCGATGCGATTCCGCGACGAGTCCTGGGGAGGGCATCGTATCATTCGGCTACACATTCGGCTACAAGTGCGGACTGAAGAGTCTACACGAACGTGGCTGCCTATGGCTGCCTACGACATCTGGATCAGGGCTTAGGTCCCGAATTCAAACTGAAATCAGGTGCACGACATTGGTCTCAATTGGTCTCATTCGCATGGAGCGCATACTCGGACAACATTCAGCCCATTTAGTCGAGGCAATCCGGCCAGCAGTT

Full Affymetrix probeset data:

Annotations for 1640085_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720