FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640086_at:

>probe:Drosophila_2:1640086_at:677:519; Interrogation_Position=131; Antisense; GTGGAATACGCTTTCCTTCTGGGAC
>probe:Drosophila_2:1640086_at:30:713; Interrogation_Position=147; Antisense; TTCTGGGACGGTCAACCAGTCACTT
>probe:Drosophila_2:1640086_at:36:543; Interrogation_Position=194; Antisense; GGATATGTGGAACCCCAATACCGCC
>probe:Drosophila_2:1640086_at:184:381; Interrogation_Position=245; Antisense; GAACCATTCGCATAGCAATTACTTT
>probe:Drosophila_2:1640086_at:608:361; Interrogation_Position=259; Antisense; GCAATTACTTTCAACGGATGGGCAT
>probe:Drosophila_2:1640086_at:234:593; Interrogation_Position=277; Antisense; TGGGCATGGGTGACATTCGCCAGAT
>probe:Drosophila_2:1640086_at:630:443; Interrogation_Position=299; Antisense; GATGAGCTGTCCCATGCCGAACTAC
>probe:Drosophila_2:1640086_at:146:383; Interrogation_Position=317; Antisense; GAACTACTGTCCTCAATTCCGGGAG
>probe:Drosophila_2:1640086_at:723:407; Interrogation_Position=351; Antisense; GACGATGTGGATGCCTTTTACGCTT
>probe:Drosophila_2:1640086_at:387:699; Interrogation_Position=367; Antisense; TTTACGCTTACAACGGCATGGATAT
>probe:Drosophila_2:1640086_at:591:587; Interrogation_Position=385; Antisense; TGGATATAACTCAGGCCTACGGCGG
>probe:Drosophila_2:1640086_at:18:311; Interrogation_Position=451; Antisense; GCGACTTTTGGTAGTAACTCGTCAA
>probe:Drosophila_2:1640086_at:331:193; Interrogation_Position=466; Antisense; AACTCGTCAACCAATACCTGGCGTA
>probe:Drosophila_2:1640086_at:186:305; Interrogation_Position=482; Antisense; CCTGGCGTATGCTTCTTAATTTTCT

Paste this into a BLAST search page for me
GTGGAATACGCTTTCCTTCTGGGACTTCTGGGACGGTCAACCAGTCACTTGGATATGTGGAACCCCAATACCGCCGAACCATTCGCATAGCAATTACTTTGCAATTACTTTCAACGGATGGGCATTGGGCATGGGTGACATTCGCCAGATGATGAGCTGTCCCATGCCGAACTACGAACTACTGTCCTCAATTCCGGGAGGACGATGTGGATGCCTTTTACGCTTTTTACGCTTACAACGGCATGGATATTGGATATAACTCAGGCCTACGGCGGGCGACTTTTGGTAGTAACTCGTCAAAACTCGTCAACCAATACCTGGCGTACCTGGCGTATGCTTCTTAATTTTCT

Full Affymetrix probeset data:

Annotations for 1640086_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720