FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640087_at:

>probe:Drosophila_2:1640087_at:727:705; Interrogation_Position=372; Antisense; TTACGGCCTGGATGGCATGGATGCC
>probe:Drosophila_2:1640087_at:284:27; Interrogation_Position=447; Antisense; ATACGATGTGCGACAGCGGACCATT
>probe:Drosophila_2:1640087_at:692:679; Interrogation_Position=479; Antisense; TATGGGACATTACCGTCTCGCTCAA
>probe:Drosophila_2:1640087_at:231:499; Interrogation_Position=493; Antisense; GTCTCGCTCAACATTCTGTACAAGG
>probe:Drosophila_2:1640087_at:157:163; Interrogation_Position=529; Antisense; AAATTAGCCGCACTTGAAATAGCCA
>probe:Drosophila_2:1640087_at:468:443; Interrogation_Position=589; Antisense; GATGTTATGCTGCAATTATCGCACG
>probe:Drosophila_2:1640087_at:603:703; Interrogation_Position=604; Antisense; TTATCGCACGACGATGTGGCCAACG
>probe:Drosophila_2:1640087_at:713:321; Interrogation_Position=686; Antisense; GCGCCTCTGGTGTTCCGGGTAGCAA
>probe:Drosophila_2:1640087_at:196:529; Interrogation_Position=702; Antisense; GGGTAGCAACAATCCGGCCACGGAA
>probe:Drosophila_2:1640087_at:625:147; Interrogation_Position=746; Antisense; ACTATCACCATCATCGTGCCGGAGG
>probe:Drosophila_2:1640087_at:297:587; Interrogation_Position=795; Antisense; TGGACCGCCGCATGAGTGGAATTTT
>probe:Drosophila_2:1640087_at:149:329; Interrogation_Position=826; Antisense; GCGTTTTTGTATTCGCTGACCGTTT
>probe:Drosophila_2:1640087_at:539:323; Interrogation_Position=840; Antisense; GCTGACCGTTTTGACCACAATTGTG
>probe:Drosophila_2:1640087_at:443:277; Interrogation_Position=936; Antisense; CGGGCATGACCCGTACACCTTTTGA

Paste this into a BLAST search page for me
TTACGGCCTGGATGGCATGGATGCCATACGATGTGCGACAGCGGACCATTTATGGGACATTACCGTCTCGCTCAAGTCTCGCTCAACATTCTGTACAAGGAAATTAGCCGCACTTGAAATAGCCAGATGTTATGCTGCAATTATCGCACGTTATCGCACGACGATGTGGCCAACGGCGCCTCTGGTGTTCCGGGTAGCAAGGGTAGCAACAATCCGGCCACGGAAACTATCACCATCATCGTGCCGGAGGTGGACCGCCGCATGAGTGGAATTTTGCGTTTTTGTATTCGCTGACCGTTTGCTGACCGTTTTGACCACAATTGTGCGGGCATGACCCGTACACCTTTTGA

Full Affymetrix probeset data:

Annotations for 1640087_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720