Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640088_at:

>probe:Drosophila_2:1640088_at:33:563; Interrogation_Position=1872; Antisense; GGAACTCATAAGATCACCCTAGACA
>probe:Drosophila_2:1640088_at:326:169; Interrogation_Position=1940; Antisense; AAAGGGATACCGTCGTCTGGCACCG
>probe:Drosophila_2:1640088_at:304:375; Interrogation_Position=1964; Antisense; GAAGCAATCTGTGGGTCTCCGGCAC
>probe:Drosophila_2:1640088_at:267:291; Interrogation_Position=1990; Antisense; CGGGTCTCGTAATCAGCGTGGATGA
>probe:Drosophila_2:1640088_at:304:521; Interrogation_Position=2046; Antisense; GTGGAACTAATCTGCACCAGCCAAC
>probe:Drosophila_2:1640088_at:419:377; Interrogation_Position=2087; Antisense; GAAGCCCAAGGCTTTTGTCCAGTGG
>probe:Drosophila_2:1640088_at:376:729; Interrogation_Position=2101; Antisense; TTGTCCAGTGGGTATCGCAGCCGAT
>probe:Drosophila_2:1640088_at:371:373; Interrogation_Position=2133; Antisense; GAAGTGCGTCTGTACGAGCAGCTCT
>probe:Drosophila_2:1640088_at:225:109; Interrogation_Position=2167; Antisense; AGAATCCCGAGGATCCCAACGAGGT
>probe:Drosophila_2:1640088_at:688:329; Interrogation_Position=2197; Antisense; GCGGTTTCCTGAGCGACATCAGTGA
>probe:Drosophila_2:1640088_at:100:251; Interrogation_Position=2223; Antisense; CAATCCATGTCGGTGGTGGTGGCAT
>probe:Drosophila_2:1640088_at:97:101; Interrogation_Position=2299; Antisense; AGAGGATTGGCTTCTTCTCCGTAGA
>probe:Drosophila_2:1640088_at:687:485; Interrogation_Position=2319; Antisense; GTAGATCCTGACACCAGTGCGAACC
>probe:Drosophila_2:1640088_at:380:513; Interrogation_Position=2349; Antisense; GTGTTCAACCGCACTGTGGGATTGA

Paste this into a BLAST search page for me
GGAACTCATAAGATCACCCTAGACAAAAGGGATACCGTCGTCTGGCACCGGAAGCAATCTGTGGGTCTCCGGCACCGGGTCTCGTAATCAGCGTGGATGAGTGGAACTAATCTGCACCAGCCAACGAAGCCCAAGGCTTTTGTCCAGTGGTTGTCCAGTGGGTATCGCAGCCGATGAAGTGCGTCTGTACGAGCAGCTCTAGAATCCCGAGGATCCCAACGAGGTGCGGTTTCCTGAGCGACATCAGTGACAATCCATGTCGGTGGTGGTGGCATAGAGGATTGGCTTCTTCTCCGTAGAGTAGATCCTGACACCAGTGCGAACCGTGTTCAACCGCACTGTGGGATTGA

Full Affymetrix probeset data:

Annotations for 1640088_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime