Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640089_at:

>probe:Drosophila_2:1640089_at:247:135; Interrogation_Position=3788; Antisense; ACGAGCGATCCCTGGTTTTCGAGAT
>probe:Drosophila_2:1640089_at:78:541; Interrogation_Position=3801; Antisense; GGTTTTCGAGATCTGCTGCAACGAT
>probe:Drosophila_2:1640089_at:648:517; Interrogation_Position=3841; Antisense; GTGGAGGTGCCCTACGTCCGTTACA
>probe:Drosophila_2:1640089_at:374:305; Interrogation_Position=3872; Antisense; CCTAAGCCCGTCTATATTCCTAATT
>probe:Drosophila_2:1640089_at:455:671; Interrogation_Position=3914; Antisense; TACGATCCCGTTTTGTTGTCGGCGA
>probe:Drosophila_2:1640089_at:602:597; Interrogation_Position=3930; Antisense; TGTCGGCGACGCGTTTTGGAATCGC
>probe:Drosophila_2:1640089_at:2:585; Interrogation_Position=3946; Antisense; TGGAATCGCGCAGCTCCAACGAAGG
>probe:Drosophila_2:1640089_at:192:551; Interrogation_Position=3969; Antisense; GGAGTTACTGTCTAGCTGTTTGCAT
>probe:Drosophila_2:1640089_at:556:243; Interrogation_Position=3997; Antisense; AATTTTCACAACACCATTACGAGAG
>probe:Drosophila_2:1640089_at:164:13; Interrogation_Position=4012; Antisense; ATTACGAGAGCAGCCCAGATCTAGA
>probe:Drosophila_2:1640089_at:230:169; Interrogation_Position=4046; Antisense; AAATGTGTGTGAATCCTCTAAGGAA
>probe:Drosophila_2:1640089_at:108:445; Interrogation_Position=4137; Antisense; GATGAAACTCTCTGCTCAGCATAGT
>probe:Drosophila_2:1640089_at:519:191; Interrogation_Position=4185; Antisense; AACCGAAGGCGGATTTTAATCGCAT
>probe:Drosophila_2:1640089_at:439:527; Interrogation_Position=4243; Antisense; GGCGGAAAATTTCTCTTCACTCATA

Paste this into a BLAST search page for me
ACGAGCGATCCCTGGTTTTCGAGATGGTTTTCGAGATCTGCTGCAACGATGTGGAGGTGCCCTACGTCCGTTACACCTAAGCCCGTCTATATTCCTAATTTACGATCCCGTTTTGTTGTCGGCGATGTCGGCGACGCGTTTTGGAATCGCTGGAATCGCGCAGCTCCAACGAAGGGGAGTTACTGTCTAGCTGTTTGCATAATTTTCACAACACCATTACGAGAGATTACGAGAGCAGCCCAGATCTAGAAAATGTGTGTGAATCCTCTAAGGAAGATGAAACTCTCTGCTCAGCATAGTAACCGAAGGCGGATTTTAATCGCATGGCGGAAAATTTCTCTTCACTCATA

Full Affymetrix probeset data:

Annotations for 1640089_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime