FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640091_at:

>probe:Drosophila_2:1640091_at:348:29; Interrogation_Position=1068; Antisense; ATACGGAATACCTCTGGACTGCATT
>probe:Drosophila_2:1640091_at:212:723; Interrogation_Position=1108; Antisense; TTGCACGAGTTTTGGGCATACCCGA
>probe:Drosophila_2:1640091_at:298:51; Interrogation_Position=1141; Antisense; ATGCGTTGGATATGTCCGCCATGGA
>probe:Drosophila_2:1640091_at:334:225; Interrogation_Position=1228; Antisense; AAGGAGCCCGCAATCTGGTGGTCTA
>probe:Drosophila_2:1640091_at:461:643; Interrogation_Position=1249; Antisense; TCTACGCAGAGTTGAGCATGTCGCT
>probe:Drosophila_2:1640091_at:571:121; Interrogation_Position=1303; Antisense; AGCGTCTCAATCTATCGGCGGGCGG
>probe:Drosophila_2:1640091_at:424:307; Interrogation_Position=1340; Antisense; GCCTTCCGAGGAGAGTCTGCTTAGA
>probe:Drosophila_2:1640091_at:418:177; Interrogation_Position=1364; Antisense; AAACGTCAGCGATCTTATGCAGCCG
>probe:Drosophila_2:1640091_at:41:407; Interrogation_Position=1409; Antisense; GACTGTGAACCATGGCTACGATCAT
>probe:Drosophila_2:1640091_at:440:453; Interrogation_Position=1428; Antisense; GATCATGCCAGCGATAATGCCGTGG
>probe:Drosophila_2:1640091_at:44:291; Interrogation_Position=1448; Antisense; CGTGGAGGCCCTGACCATGAAGGAA
>probe:Drosophila_2:1640091_at:25:71; Interrogation_Position=1486; Antisense; AGGCTATTCTCGATCTCAACGTGGA
>probe:Drosophila_2:1640091_at:643:585; Interrogation_Position=1507; Antisense; TGGACTTCTTCCAGTTCAATCCGAA
>probe:Drosophila_2:1640091_at:47:439; Interrogation_Position=990; Antisense; GAGGAACAGCGCTCTGATCTCTTTC

Paste this into a BLAST search page for me
ATACGGAATACCTCTGGACTGCATTTTGCACGAGTTTTGGGCATACCCGAATGCGTTGGATATGTCCGCCATGGAAAGGAGCCCGCAATCTGGTGGTCTATCTACGCAGAGTTGAGCATGTCGCTAGCGTCTCAATCTATCGGCGGGCGGGCCTTCCGAGGAGAGTCTGCTTAGAAAACGTCAGCGATCTTATGCAGCCGGACTGTGAACCATGGCTACGATCATGATCATGCCAGCGATAATGCCGTGGCGTGGAGGCCCTGACCATGAAGGAAAGGCTATTCTCGATCTCAACGTGGATGGACTTCTTCCAGTTCAATCCGAAGAGGAACAGCGCTCTGATCTCTTTC

Full Affymetrix probeset data:

Annotations for 1640091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720