Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640095_at:

>probe:Drosophila_2:1640095_at:444:199; Interrogation_Position=283; Antisense; AACCGTTACGAGAACTGGTCGCCAG
>probe:Drosophila_2:1640095_at:24:219; Interrogation_Position=352; Antisense; AAGTGGACCACGCAGTCGCCGAAGT
>probe:Drosophila_2:1640095_at:193:669; Interrogation_Position=415; Antisense; TATGATCCCGAGGTGGAACCCTATG
>probe:Drosophila_2:1640095_at:385:381; Interrogation_Position=430; Antisense; GAACCCTATGAGGATGTGCGGTCTC
>probe:Drosophila_2:1640095_at:184:537; Interrogation_Position=449; Antisense; GGTCTCAGCCGCTTTATGATCCGTA
>probe:Drosophila_2:1640095_at:361:399; Interrogation_Position=486; Antisense; GACACCGCATGAAGTAGCTCACTAT
>probe:Drosophila_2:1640095_at:310:709; Interrogation_Position=543; Antisense; TTACAACGGACATCGCGATCGCAGG
>probe:Drosophila_2:1640095_at:572:117; Interrogation_Position=569; Antisense; AGCTCTTTGAGCACTTTGATGGTTT
>probe:Drosophila_2:1640095_at:244:175; Interrogation_Position=619; Antisense; AAAGCCTGTGTTTTGAGAGCCATCT
>probe:Drosophila_2:1640095_at:244:41; Interrogation_Position=640; Antisense; ATCTGTGATAGCAAGCGCCTGCTTC
>probe:Drosophila_2:1640095_at:658:275; Interrogation_Position=661; Antisense; CTTCTGCCTCGTGGATATTCGATGA
>probe:Drosophila_2:1640095_at:64:727; Interrogation_Position=704; Antisense; TTGTGTTTACACTACCAACCGCATC
>probe:Drosophila_2:1640095_at:8:641; Interrogation_Position=790; Antisense; TTTCGCGACTCGTGTAAGCTAAACT
>probe:Drosophila_2:1640095_at:705:339; Interrogation_Position=807; Antisense; GCTAAACTTACTGGCCTGGCTAATG

Paste this into a BLAST search page for me
AACCGTTACGAGAACTGGTCGCCAGAAGTGGACCACGCAGTCGCCGAAGTTATGATCCCGAGGTGGAACCCTATGGAACCCTATGAGGATGTGCGGTCTCGGTCTCAGCCGCTTTATGATCCGTAGACACCGCATGAAGTAGCTCACTATTTACAACGGACATCGCGATCGCAGGAGCTCTTTGAGCACTTTGATGGTTTAAAGCCTGTGTTTTGAGAGCCATCTATCTGTGATAGCAAGCGCCTGCTTCCTTCTGCCTCGTGGATATTCGATGATTGTGTTTACACTACCAACCGCATCTTTCGCGACTCGTGTAAGCTAAACTGCTAAACTTACTGGCCTGGCTAATG

Full Affymetrix probeset data:

Annotations for 1640095_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime