FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640096_at:

>probe:Drosophila_2:1640096_at:87:603; Interrogation_Position=2715; Antisense; TGTTTCTAAAACACTCCCTGCTATT
>probe:Drosophila_2:1640096_at:607:341; Interrogation_Position=2734; Antisense; GCTATTCCTTAAATTGCTGCTTCAG
>probe:Drosophila_2:1640096_at:600:259; Interrogation_Position=2759; Antisense; CACGGAATGTCTGCGCTGGAATCTA
>probe:Drosophila_2:1640096_at:275:161; Interrogation_Position=2810; Antisense; ACAAGGTTTTTGCACGAGCTCCAGA
>probe:Drosophila_2:1640096_at:213:373; Interrogation_Position=2833; Antisense; GAAGGTGACACGCTTTCTGCACCAA
>probe:Drosophila_2:1640096_at:306:33; Interrogation_Position=2894; Antisense; ATAATCAGCTATATTCCCAGCCTGC
>probe:Drosophila_2:1640096_at:458:423; Interrogation_Position=2930; Antisense; GAGACGCTGGTCTTCCGAGTCAAAG
>probe:Drosophila_2:1640096_at:140:431; Interrogation_Position=2946; Antisense; GAGTCAAAGCCCTGTTGGCTGCCAA
>probe:Drosophila_2:1640096_at:613:729; Interrogation_Position=2960; Antisense; TTGGCTGCCAACAACTGTCATTCTG
>probe:Drosophila_2:1640096_at:632:599; Interrogation_Position=2975; Antisense; TGTCATTCTGCTTTCCACATGGGAA
>probe:Drosophila_2:1640096_at:50:429; Interrogation_Position=3024; Antisense; GAGATTCTATCATAACACCCAGGAG
>probe:Drosophila_2:1640096_at:628:441; Interrogation_Position=3077; Antisense; GATGAATTACCTGCGGACGACACCA
>probe:Drosophila_2:1640096_at:513:55; Interrogation_Position=3108; Antisense; ATGAAACCGTCTTGGGCGATGACAT
>probe:Drosophila_2:1640096_at:573:675; Interrogation_Position=3148; Antisense; TAGCGTGAGCACAAGGCCCAGCGAT

Paste this into a BLAST search page for me
TGTTTCTAAAACACTCCCTGCTATTGCTATTCCTTAAATTGCTGCTTCAGCACGGAATGTCTGCGCTGGAATCTAACAAGGTTTTTGCACGAGCTCCAGAGAAGGTGACACGCTTTCTGCACCAAATAATCAGCTATATTCCCAGCCTGCGAGACGCTGGTCTTCCGAGTCAAAGGAGTCAAAGCCCTGTTGGCTGCCAATTGGCTGCCAACAACTGTCATTCTGTGTCATTCTGCTTTCCACATGGGAAGAGATTCTATCATAACACCCAGGAGGATGAATTACCTGCGGACGACACCAATGAAACCGTCTTGGGCGATGACATTAGCGTGAGCACAAGGCCCAGCGAT

Full Affymetrix probeset data:

Annotations for 1640096_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720