Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640097_at:

>probe:Drosophila_2:1640097_at:60:209; Interrogation_Position=4536; Antisense; AAGCTATGACAGTCCGCTGGAATCC
>probe:Drosophila_2:1640097_at:577:331; Interrogation_Position=4551; Antisense; GCTGGAATCCCTCTACGATGTGAAC
>probe:Drosophila_2:1640097_at:626:381; Interrogation_Position=4600; Antisense; GAACTGATTGGTAGCTTCCAGAAGG
>probe:Drosophila_2:1640097_at:514:189; Interrogation_Position=4654; Antisense; AAGTTGGAGGACTCCTGCAACTCCG
>probe:Drosophila_2:1640097_at:528:261; Interrogation_Position=4729; Antisense; CAGCTGGTTTCCAAGCCCAAGAGGA
>probe:Drosophila_2:1640097_at:193:161; Interrogation_Position=4769; Antisense; ACAAGGGCACCACACGGCTGAACAA
>probe:Drosophila_2:1640097_at:139:335; Interrogation_Position=4785; Antisense; GCTGAACAACGAGGTCTGGTCTCCG
>probe:Drosophila_2:1640097_at:569:219; Interrogation_Position=4822; Antisense; AAGTGCAACTGCTTCCACGGCCAGG
>probe:Drosophila_2:1640097_at:223:141; Interrogation_Position=4838; Antisense; ACGGCCAGGTCAATTGCCTGAGGGA
>probe:Drosophila_2:1640097_at:571:309; Interrogation_Position=4927; Antisense; CCACACTGCCCGATGGTCAAGTGAA
>probe:Drosophila_2:1640097_at:85:293; Interrogation_Position=4979; Antisense; CGACGTTTATCCGTAGTAGCCACAC
>probe:Drosophila_2:1640097_at:530:487; Interrogation_Position=4994; Antisense; GTAGCCACACTCACTCTAATCAAAA
>probe:Drosophila_2:1640097_at:634:389; Interrogation_Position=5027; Antisense; GAAACACACCGGCAATTGCGCAATG
>probe:Drosophila_2:1640097_at:59:187; Interrogation_Position=5076; Antisense; AACAATGTACTGCTACACGTGTAAT

Paste this into a BLAST search page for me
AAGCTATGACAGTCCGCTGGAATCCGCTGGAATCCCTCTACGATGTGAACGAACTGATTGGTAGCTTCCAGAAGGAAGTTGGAGGACTCCTGCAACTCCGCAGCTGGTTTCCAAGCCCAAGAGGAACAAGGGCACCACACGGCTGAACAAGCTGAACAACGAGGTCTGGTCTCCGAAGTGCAACTGCTTCCACGGCCAGGACGGCCAGGTCAATTGCCTGAGGGACCACACTGCCCGATGGTCAAGTGAACGACGTTTATCCGTAGTAGCCACACGTAGCCACACTCACTCTAATCAAAAGAAACACACCGGCAATTGCGCAATGAACAATGTACTGCTACACGTGTAAT

Full Affymetrix probeset data:

Annotations for 1640097_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime