Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640098_at:

>probe:Drosophila_2:1640098_at:367:49; Interrogation_Position=6647; Antisense; ATGCCAGCTCTCAGGAGCGATCACA
>probe:Drosophila_2:1640098_at:364:155; Interrogation_Position=6732; Antisense; ACAGCAGGTGAACGTTAGCAGCAGA
>probe:Drosophila_2:1640098_at:348:267; Interrogation_Position=6759; Antisense; CAGGGTGCGCAAGCCGTCTGCCAAG
>probe:Drosophila_2:1640098_at:562:227; Interrogation_Position=6781; Antisense; AAGGCGCGCGGTATCTTCAAGGAGT
>probe:Drosophila_2:1640098_at:669:709; Interrogation_Position=6796; Antisense; TTCAAGGAGTGACCGCAGACTGTTT
>probe:Drosophila_2:1640098_at:132:413; Interrogation_Position=6806; Antisense; GACCGCAGACTGTTTTATGTATAAA
>probe:Drosophila_2:1640098_at:459:125; Interrogation_Position=6856; Antisense; ACCTTTGTAACATTTGCTAGAGTCT
>probe:Drosophila_2:1640098_at:614:429; Interrogation_Position=6908; Antisense; GAGTAAATCACGTCACTTCTCATTG
>probe:Drosophila_2:1640098_at:730:491; Interrogation_Position=6932; Antisense; GTAATGTCAGTGTCACCGCTACGGT
>probe:Drosophila_2:1640098_at:421:373; Interrogation_Position=7010; Antisense; GAAGTGTTAGCCCATATCCATCATA
>probe:Drosophila_2:1640098_at:662:683; Interrogation_Position=7024; Antisense; TATCCATCATACACCGTGGCAGAAT
>probe:Drosophila_2:1640098_at:158:583; Interrogation_Position=7084; Antisense; TGGCATCAGTCCTACATTCTATGTG
>probe:Drosophila_2:1640098_at:185:525; Interrogation_Position=7113; Antisense; GGGCATGGCCAAAGCAACGTTTTAT
>probe:Drosophila_2:1640098_at:337:487; Interrogation_Position=7185; Antisense; GTAGCACTCGGAATCACACTTCATT

Paste this into a BLAST search page for me
ATGCCAGCTCTCAGGAGCGATCACAACAGCAGGTGAACGTTAGCAGCAGACAGGGTGCGCAAGCCGTCTGCCAAGAAGGCGCGCGGTATCTTCAAGGAGTTTCAAGGAGTGACCGCAGACTGTTTGACCGCAGACTGTTTTATGTATAAAACCTTTGTAACATTTGCTAGAGTCTGAGTAAATCACGTCACTTCTCATTGGTAATGTCAGTGTCACCGCTACGGTGAAGTGTTAGCCCATATCCATCATATATCCATCATACACCGTGGCAGAATTGGCATCAGTCCTACATTCTATGTGGGGCATGGCCAAAGCAACGTTTTATGTAGCACTCGGAATCACACTTCATT

Full Affymetrix probeset data:

Annotations for 1640098_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime