Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640099_at:

>probe:Drosophila_2:1640099_at:434:585; Interrogation_Position=1070; Antisense; TGGCAAGTACATTTTGGCCGCCACG
>probe:Drosophila_2:1640099_at:122:313; Interrogation_Position=1089; Antisense; GCCACGCTGGATAATACGCTCAAGT
>probe:Drosophila_2:1640099_at:581:133; Interrogation_Position=1104; Antisense; ACGCTCAAGTTGTGGGACTACTCGA
>probe:Drosophila_2:1640099_at:183:527; Interrogation_Position=1130; Antisense; GGGCAAGTGCCTGAAGACGTATACG
>probe:Drosophila_2:1640099_at:645:421; Interrogation_Position=1167; Antisense; GAGAAGTACTGCATATTCGCCAACT
>probe:Drosophila_2:1640099_at:207:11; Interrogation_Position=1181; Antisense; ATTCGCCAACTTCTCGGTGACGGGA
>probe:Drosophila_2:1640099_at:476:269; Interrogation_Position=1238; Antisense; CATGGTCTACATTTGGAATCTGCAG
>probe:Drosophila_2:1640099_at:49:183; Interrogation_Position=1279; Antisense; AAAAGCTGCAGGGACACACCGATAC
>probe:Drosophila_2:1640099_at:379:423; Interrogation_Position=1332; Antisense; GAGAACATCATTGCTTCCGCGGCGC
>probe:Drosophila_2:1640099_at:664:717; Interrogation_Position=1346; Antisense; TTCCGCGGCGCTCGAGAACGACAAG
>probe:Drosophila_2:1640099_at:666:481; Interrogation_Position=1409; Antisense; GTATCCAGCTGGAGGACGTTCGATC
>probe:Drosophila_2:1640099_at:643:713; Interrogation_Position=1427; Antisense; TTCGATCGGAACACACACATACATT
>probe:Drosophila_2:1640099_at:192:205; Interrogation_Position=1472; Antisense; AAGCGAACAGCCTAATCGTAATTGT
>probe:Drosophila_2:1640099_at:166:35; Interrogation_Position=1587; Antisense; ATCACACTTTAAACCTCACATTCTA

Paste this into a BLAST search page for me
TGGCAAGTACATTTTGGCCGCCACGGCCACGCTGGATAATACGCTCAAGTACGCTCAAGTTGTGGGACTACTCGAGGGCAAGTGCCTGAAGACGTATACGGAGAAGTACTGCATATTCGCCAACTATTCGCCAACTTCTCGGTGACGGGACATGGTCTACATTTGGAATCTGCAGAAAAGCTGCAGGGACACACCGATACGAGAACATCATTGCTTCCGCGGCGCTTCCGCGGCGCTCGAGAACGACAAGGTATCCAGCTGGAGGACGTTCGATCTTCGATCGGAACACACACATACATTAAGCGAACAGCCTAATCGTAATTGTATCACACTTTAAACCTCACATTCTA

Full Affymetrix probeset data:

Annotations for 1640099_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime