FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640101_at:

>probe:Drosophila_2:1640101_at:162:379; Interrogation_Position=1066; Antisense; GAAGCGAGAACGGTACCTCCGCAGG
>probe:Drosophila_2:1640101_at:258:67; Interrogation_Position=1150; Antisense; ATGGAGCCAGCCTAAGATGTTTTTT
>probe:Drosophila_2:1640101_at:221:691; Interrogation_Position=616; Antisense; TTTGGAATCCCTACCCATTTTAGAG
>probe:Drosophila_2:1640101_at:415:583; Interrogation_Position=670; Antisense; TGGCAACAACCCCTTTTACTGTGAA
>probe:Drosophila_2:1640101_at:714:579; Interrogation_Position=726; Antisense; GGCCAATTCATCAAACATCCACAGT
>probe:Drosophila_2:1640101_at:597:151; Interrogation_Position=740; Antisense; ACATCCACAGTGCATCAGTTCAATC
>probe:Drosophila_2:1640101_at:87:93; Interrogation_Position=756; Antisense; AGTTCAATCTAAAGGCTCTGCCCGC
>probe:Drosophila_2:1640101_at:121:237; Interrogation_Position=815; Antisense; AATCGAGGACTCCAGCTGATGGTGA
>probe:Drosophila_2:1640101_at:254:171; Interrogation_Position=879; Antisense; AAAGTGGGCGATTGTATCCCGTCAA
>probe:Drosophila_2:1640101_at:706:45; Interrogation_Position=894; Antisense; ATCCCGTCAAGACTGTTCTTCGAAA
>probe:Drosophila_2:1640101_at:153:393; Interrogation_Position=915; Antisense; GAAAGCAACGCACTGGACTGGGAAT
>probe:Drosophila_2:1640101_at:599:185; Interrogation_Position=942; Antisense; AACAGCAGTCGGCAAGGGTCTCCCA
>probe:Drosophila_2:1640101_at:393:689; Interrogation_Position=968; Antisense; TTTGGTGCCTTCGATTTAAACGCTG
>probe:Drosophila_2:1640101_at:187:373; Interrogation_Position=999; Antisense; GAAGGGATCCCATATATCAGCCGAG

Paste this into a BLAST search page for me
GAAGCGAGAACGGTACCTCCGCAGGATGGAGCCAGCCTAAGATGTTTTTTTTTGGAATCCCTACCCATTTTAGAGTGGCAACAACCCCTTTTACTGTGAAGGCCAATTCATCAAACATCCACAGTACATCCACAGTGCATCAGTTCAATCAGTTCAATCTAAAGGCTCTGCCCGCAATCGAGGACTCCAGCTGATGGTGAAAAGTGGGCGATTGTATCCCGTCAAATCCCGTCAAGACTGTTCTTCGAAAGAAAGCAACGCACTGGACTGGGAATAACAGCAGTCGGCAAGGGTCTCCCATTTGGTGCCTTCGATTTAAACGCTGGAAGGGATCCCATATATCAGCCGAG

Full Affymetrix probeset data:

Annotations for 1640101_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720