Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640103_s_at:

>probe:Drosophila_2:1640103_s_at:433:443; Interrogation_Position=1047; Antisense; GATGTATGCGTGACCCTGATCGATC
>probe:Drosophila_2:1640103_s_at:156:209; Interrogation_Position=1110; Antisense; AAGCACGAATTCGAGCAGCGTCCCT
>probe:Drosophila_2:1640103_s_at:288:715; Interrogation_Position=1137; Antisense; TTCGTCGTGGGTCGCTACATTAAGA
>probe:Drosophila_2:1640103_s_at:695:667; Interrogation_Position=1165; Antisense; TACTGCAGCAGTGAATCCTCTAGAA
>probe:Drosophila_2:1640103_s_at:16:183; Interrogation_Position=1231; Antisense; AAAACTGCATGCTGCACTTTGCTCT
>probe:Drosophila_2:1640103_s_at:246:507; Interrogation_Position=1256; Antisense; GTGCCATTCCAGCTAACCAGAGACA
>probe:Drosophila_2:1640103_s_at:726:287; Interrogation_Position=781; Antisense; CGGCTCAGTTTTCCGAGGACGTGAT
>probe:Drosophila_2:1640103_s_at:512:459; Interrogation_Position=810; Antisense; GATTTACTTGCATTCGGTGTCGACG
>probe:Drosophila_2:1640103_s_at:97:533; Interrogation_Position=825; Antisense; GGTGTCGACGCCAACGACGGATTTC
>probe:Drosophila_2:1640103_s_at:471:407; Interrogation_Position=840; Antisense; GACGGATTTCAGACCATAAGTGCCA
>probe:Drosophila_2:1640103_s_at:568:705; Interrogation_Position=887; Antisense; TTACGAAGGTCAAGGTCGCACCGAT
>probe:Drosophila_2:1640103_s_at:384:65; Interrogation_Position=910; Antisense; ATGGAGCCATATGCGAGTACTCGGA
>probe:Drosophila_2:1640103_s_at:241:87; Interrogation_Position=961; Antisense; AGTGCCACGATCTGGGAATCCGGAA
>probe:Drosophila_2:1640103_s_at:293:99; Interrogation_Position=991; Antisense; AGATGGAGGCCAGCATGTTCGCCTC

Paste this into a BLAST search page for me
GATGTATGCGTGACCCTGATCGATCAAGCACGAATTCGAGCAGCGTCCCTTTCGTCGTGGGTCGCTACATTAAGATACTGCAGCAGTGAATCCTCTAGAAAAAACTGCATGCTGCACTTTGCTCTGTGCCATTCCAGCTAACCAGAGACACGGCTCAGTTTTCCGAGGACGTGATGATTTACTTGCATTCGGTGTCGACGGGTGTCGACGCCAACGACGGATTTCGACGGATTTCAGACCATAAGTGCCATTACGAAGGTCAAGGTCGCACCGATATGGAGCCATATGCGAGTACTCGGAAGTGCCACGATCTGGGAATCCGGAAAGATGGAGGCCAGCATGTTCGCCTC

Full Affymetrix probeset data:

Annotations for 1640103_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime