FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640104_at:

>probe:Drosophila_2:1640104_at:480:317; Interrogation_Position=358; Antisense; GCCGGACGCTATGCGGCCAAGAGAT
>probe:Drosophila_2:1640104_at:68:215; Interrogation_Position=376; Antisense; AAGAGATTCCGCAAGGCCCAATGCC
>probe:Drosophila_2:1640104_at:666:415; Interrogation_Position=409; Antisense; GAGCGCCTCACCAGCGGGCTGATGA
>probe:Drosophila_2:1640104_at:709:669; Interrogation_Position=490; Antisense; TTCGAGATCATCCATCTGCTAACCT
>probe:Drosophila_2:1640104_at:471:37; Interrogation_Position=503; Antisense; ATCTGCTAACCTCGGAGAATCCGCT
>probe:Drosophila_2:1640104_at:160:109; Interrogation_Position=518; Antisense; AGAATCCGCTTCAGGTCACCGTCAA
>probe:Drosophila_2:1640104_at:493:723; Interrogation_Position=631; Antisense; TTGCGTCGTGTCAACCAGGCAATTT
>probe:Drosophila_2:1640104_at:573:729; Interrogation_Position=654; Antisense; TTGGCTAATCTGCACTGGAGCACGT
>probe:Drosophila_2:1640104_at:456:421; Interrogation_Position=671; Antisense; GAGCACGTGAGGCTGCCTTCCGCAA
>probe:Drosophila_2:1640104_at:608:295; Interrogation_Position=691; Antisense; CGCAACATCAAGACGGTGGCCGAGT
>probe:Drosophila_2:1640104_at:352:417; Interrogation_Position=790; Antisense; GAGCGCGTGGCCAAGTCGAATCGTT
>probe:Drosophila_2:1640104_at:384:501; Interrogation_Position=804; Antisense; GTCGAATCGTTAAGCTGCGGATTTT
>probe:Drosophila_2:1640104_at:270:331; Interrogation_Position=820; Antisense; GCGGATTTTCTGCATTTCCATGAAT
>probe:Drosophila_2:1640104_at:623:719; Interrogation_Position=835; Antisense; TTCCATGAATTGATGCCGACTTACA

Paste this into a BLAST search page for me
GCCGGACGCTATGCGGCCAAGAGATAAGAGATTCCGCAAGGCCCAATGCCGAGCGCCTCACCAGCGGGCTGATGATTCGAGATCATCCATCTGCTAACCTATCTGCTAACCTCGGAGAATCCGCTAGAATCCGCTTCAGGTCACCGTCAATTGCGTCGTGTCAACCAGGCAATTTTTGGCTAATCTGCACTGGAGCACGTGAGCACGTGAGGCTGCCTTCCGCAACGCAACATCAAGACGGTGGCCGAGTGAGCGCGTGGCCAAGTCGAATCGTTGTCGAATCGTTAAGCTGCGGATTTTGCGGATTTTCTGCATTTCCATGAATTTCCATGAATTGATGCCGACTTACA

Full Affymetrix probeset data:

Annotations for 1640104_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720